42/ 50 The port mutation that doesn't produce a change in the amne act sequence of proten is known as Silent mutation B Chromosomal mutation C. Frame-shift mutation D. Non-sense mutation E. Missense mutation

42/ 50 The port mutation that doesn't produce a change in the amne act sequence of proten is known as Silent mutation B Chromosomal mutation C. Frame-shift mutation D. Non-sense mutation E. Missense mutation

Name: 42/50The port mutaton that doesn't produce a change in theamne ad seq
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 42/50The port mutaton that doesn't produce a change in theamne ad sequence of proten is known asSilent mutationB Chromosomal mutationC. Frame-shift mutationD. Non-sense mutationE. Missense mutation

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
Differentiate between the elements of the following pairs:a. Transitions and transversionsb. Synonymous and neutral mutationsc. Missense and nonsense mutationsd. Frameshift and nonsense mutations
1. (a)What mutation would result to a change of AUG codon to AGG? missense mutation nonsense mutation silent mutation frameshift mutation (b) Which mutation that would result to a change of amino acid in the polypeptide? missense mutation nonsense mutation silent mutation frameshift mutation
The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
Fill up the blank __________s are blood diseases caused by mutationsthat eliminate or reduce the production of globinpolypeptides from one of the clusters but not the other.These mutations can include deletions of specific genesor the LCR in either cluster.
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation B. silencing mutation C. missense mutation D. nonsense mutation E. frameshift mutation
Define the following terms:a. point mutationb. transition mutationc. transversion mutationd. silent mutatione. missense mutation
an adult with a history of tanning has his genome sequenced. The beginning of a protein coding region of his DNA reads ATGGGGATATGGCAT. If the protein coding region of a healthy adult reads ATGGGGATATGAGCAT identify the site and type of mutation. What might happen because of this mutation
Which type of mutation involves only one base pair?a. insertionb. deletionc. inversiond. substitution