5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a disease process. She isolated the fragment from the genomic DNA and then labeled the ends of the DNA with radioactive tags. This radioactively labeled fragment was then subjected to 3 restriction enzyme digest treatments: EcoRI single digest, BamHI single digest and EcoRI/BamHI double digest. The results are shown on the following table. The asterisk (*) indicated fragments containing the radioactive label. Restriction Enzyme Fragment Size (bp) 400, 200*, 100*, 50 350*, 250, 15О* ЕcoRI + BamНІ |250, 200*, 100*, 50 ВатHI Draw the restriction map for this DNA fragment.

5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a disease process. She isolated the fragment from the genomic DNA and then labeled the ends of the DNA with radioactive tags. This radioactively labeled fragment was then subjected to 3 restriction enzyme digest treatments: EcoRI single digest, BamHI single digest and EcoRI/BamHI double digest. The results are shown on the following table. The asterisk () indicated fragments containing the radioactive label. Restriction Enzyme Fragment Size (bp) 400, 200, 100, 50 350, 250, 15О* ЕcoRI + BamНІ |250, 200, 100, 50 ВатHI Draw the restriction map for this DNA fragment.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form phosphodiester bonds when DNA are assembled Palindromic sequences are recognized by restriction enzymes Restriction enzymes recognize blunt ends Restriction enzymes recognize sticky ends Restriction enzymes originated from bacteria
1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed genes into a mammalian chromosome using restriction enzymes. b. by adding plasmids to the mammalian cells. c. by using engineered viruses as vectors. d. by using a gene gun. 2. If someone is accused of a crime, investigators can collect his or her DNA to compare the DNA of the cells found at the crime scene. To collect human DNA, investigators often swab the inside of person’s cheek. Just a few human cheek cells contain enough material to perform PCR. In a cell, the nucleus and mitochondria contain DNA that is the starting material for PCR. Identify the 4 components needed to start a PCR reaction (equipment not included)
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
What information and materials are needed to amplify region of DNA using PCR?
Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)
1. If you forgot to add nucleotides to your PCR master mix, which control reaction tube would have results that are different than they would be if you had prepared them correctly? 7. If you found that there was DNA amplification in your negative control tube, what could be an explanation for that result?
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
1 Restriction enzymes cut DNA molecules atspecific locations to produce restriction fragments witheither blunt or _______ ends