2. The restriction enzymes Xhol and Sall cut their specific sequences as shown below: Xhol 5'-c TCGAG-3' 3'-GAGCT C-5' Sall 5'-G TCGAC-3' 3'-СAGCT G-5' Can the sticky ends created by Xhol and Sall sites be ligated? If yes, can the resulting sequences be cleaved by either Xhol or Sall?

2. The restriction enzymes Xhol and Sall cut their specific sequences as shown below: Xhol 5'-c TCGAG-3' 3'-GAGCT C-5' Sall 5'-G TCGAC-3' 3'-СAGCT G-5' Can the sticky ends created by Xhol and Sall sites be ligated? If yes, can the resulting sequences be cleaved by either Xhol or Sall?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Related questions

Q: 2 Make a drawing of the simple recombinant plasmid PAMP/PKAN containing only the 3755bp and 1875bp…

A: One intriguing scenario is the union of the 3755-bp pAMP fragment with an origin of replication for…

Q: 2) Explain how the polymerase chain reaction (PCR) works and how this technique can be employed to:…

A: Technology is utilized in science, while science is used in technology. Both are vital to our…

Q: 1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of…

A: Overhangs are single stranded ends of the DNA nucleotides which are formed by when the DNA is…

Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…

Q: #16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C |…

A: The sticky ends generated after cleavage by the Xho1 and Sal1 are shown on the white board.

Q: Which of the following statements about base editing is correct? 1. It involves nCas9. 2. The end…

A: Base editing It is an alternative tool to HDR-mediated replacement. This facilitates editing of…

Q: 4. Some transposases use extensive DNA replication to leave one copy of the element behind in a…

A: Trnasposases are the enzymes that identify the inverse terminal repeat sequences within the DNA and…

Q: (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample…

A: Answer ::

Q: How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is…

A: Note-We are supposed to answer only 1 question as per Bartleby guidelines. Kindly, repost the other…

Q: 6. Describe the process of DNA sequence of interest detection, using these term appropriately,…

A: *DNA sequencing is a technique used to find the exact sequence of bases like Adenine, Guanine…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: 3. A plasmid was digested with the enzymes BglII, Nsil and XhoI. A single digest was performed with…

A: A plasmid is an extrachromosomal small DNA molecule present in a cell and is also physically…

Q: 3 The restriction endonuclease PstI cuts DNA symmetrically on both strands at the СTGCAG sequence:…

A: Restriction endonucleases are the enzymes that are used to form cuts inside the DNA molecule. It is…

Q: Amplified target regions of four different samples were separated using gel electrophoresis. DNA…

A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…

Q: 2. A plasmid was digested with the enzymes BamHI, ECORI, and HindIII. A single digest was performed…

A: A restriction map describes the location of all the restriction sites on a DNA (deoxyribonucleic…

Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…

A: Fidelity of replication is the most important for the very existence of an organism. Besides its…

Q: 1. Given the following restriction endonucleases and the sequences of their corresponding…

A: Prokaryotic cells are unicellular organisms that differ from multicellular organisms in composition…

Q: The recognition site for Spel is A'CTAGT. Which of the following restriction sites when digested…

A: Restriction site - Each restriction enzyme identify specific sequence of nucleotide, known as…

Q: 6. You perform a restriction digest that should yield 1,400 bp, 1,080 bp, 1,000 bp, and 400 bp…

A: There are different biomolecules, including DNA, RNA, proteins, etc., are present, and these…

Q: the target DNA

A: CRISPR: It stands for Clustered Regularly Interspaced Short Palindromic Repeats. These are the…

Q: 1. what are the three main steps of a solid phase DNA extraction? Answer is Lysis, but does not…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1. An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products an…

A: An inclusion could be a tiny, circular, double-stranded DNA molecule that's distinct from a cell's…

Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…

A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…

Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…

A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…

Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…

Q: 2. You are planning to clone a gene into the PBR322 plasmid vector. The gene has Bgl II restriction…

A: Gene cloning is the technique to produce the exact copies of the desired gene by utilizing genetic…

Q: 1. What happens in the denaturing step of PCR? A. What happens during the annealing step of…

A: PCR is used widely in the fields of cell Biology, Forensic Researches, medical diagnostics, and in…

Q: 7. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. The fragment was…

A: EcoRI is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction enzyme…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: he sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines…

A: EcoRI is a restriction endonuclease that is isolated from E. coli and is used in the gene cloning…

Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…

A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…

Q: 2. In order to make a recombinant plasmid for transformation, EcoRI you digested a bacterial plasmid…

A: Answer No, XxRI restrictions enzyme produces the different site as that of the bacterial…

Q: 8. Describe the possible outcome of a PCR experiment in which (a) one of the primers is…

A: Answer: Introduction: The polymerase chain reaction (PCR) technique, described by Kary Mullis in…

Q: 9. Five DNA samples are shown along with their recognition sites where a particular restriction…

A: Gel electrophoresis Gel electrophoresis is a molecular technique that involves the separation of DNA…

Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?

A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…

Q: 2. You want to clone a specific PCR amplicon. You have determined that the amplicon you want to…

A: pUC57 is a commonly used plasmid cloning vector in E. coli.

Q: 5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a…

A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…

Q: 3. Identify one advantage an organism might gain from expressing endogenous endonucleases. 4. You…

A: Recombinant DNA (deoxyribonucleic acid) technology is a technique in which DNA sequences are linked…

Q: How is a randomized DNA library created? MARK ALL THAT APPLY. the use of Mn2+ rather than Mg2+ by…

A: DNA libraries are a collection of a large number of various genes of choice kept or stored together…

Q: 2. Agarose gel clectrophoresis of PCR products from samples taken from a healthy, a carrier, and an…

A: Mutations are sudden and abrupt changes in the DNA, which can potentially change the cell process.…

Q: 7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in…

A: Any sequence of DNA which shows polymorphism and can be recognized utilizing a molecular method is…

Q: You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted…

A: PCR (polymerase chain reaction) is a technique mostly used in molecular biology to make millions to…

Q: 1. A plasmid was digested with two restriction enzymes, individually and in a double digest. The…

A: The restriction enzymes cleave DNA (deoxyribonucleic acid) molecules at specific sequences called…

Q: 1. The gel presented here shows the pattern of bands of fragments produced with several restriction…

A: The various fragments obtained in the gel are: Aatl 1 → 9kb, 3kb = 12kb.Ncol → 8kb, 4kb.Aatl 1 +…

Q: 8. You have a piece of DNA with the sequence shown below.…

A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

Q: The recognition sites for the restriction enzymes BamHI, Xbal, and Bglll are G^GATCC, T^CTAGA, and…

A: Since it is the multiple choice question i will provide answer in next step.

Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…

A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…

Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…

A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…

Q: The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in…

A: BamHI recognition sequence: GGATCC cleavage occurs between the two Gs Bgl II recognition sequence:…

Question

Please help with all parts of this problem. Double check your answers.

2. The restriction enzymes Xhol and Sall cut their specific sequences as shown below:
Xhol
5'-c
TCGAG-3'
3'-GAGCT
C-5'
Sall
5'-G
TCGAC-3'
3'-СAGCT
G-5'
Can the sticky ends created by Xhol and Sall sites be ligated? If yes, can the resulting sequences be cleaved by either Xhol or Sall?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
1. Explain how the SNP changes the recognition sequence for the restriction enzyme and affects its ability to cut the DNA. Indicate which of the 2 alleles (taster or non-taster) is cut by the restriction enzyme. 2. Predict the size of the expected DNA fragments after restriction digest for the two alternative SNP sequences (the taster and the non-taster).i.) Taster allele after being cut ii.) Non-taster allele after being cut
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
1. Below is an illustration of two plasmids: the incomplete pKAN-R which contains the gene of interest (rfp), and the good plasmid vector pARA which contains the ampR gene for ampicillin resistance, the araC activator gene and the ori region. Based on this, how are you going assemble to create the desired recombinant plasmid containing all the necessary components? (Keywords: Identify correct restriction enzymes to use to create specific sticky end sequences that will only assemble with the final vector in one orientation)
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
1. What two restriction sites are you going to use to clone your PCR product into the pL4440 plasmid? What are their DNA sequence? 2. State the primer sequence you will use to amplify the F27C1.7 gene ready to be cloned into the pL4440 plasmid? 3. How would you go about cloning this amplified DNA into pL4440? Using your knowledge of cloning list 5 important aspects of the method.
The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in both strands). The enzyme Bgl II recognizes AGATCT and cuts between AG (in both strands). Justify your answers. 1. Draw the double stranded sequences of the DNA pieces shown above and indicate with an arrow the cutting points for each of the enzymes. Use different two colors for the two different sequences (one color for BamHI and another one for BglII). Do they generate blunt ends or sticky ends? 2. Draw the two sequences arising from each the cut (there will be four sequences).
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
Amplified target regions of four different samples were separated using gel electrophoresis. DNA fragments labeled with the isotope P32 were separated by gel electrophoresis. The ultimate reason why unique target regions within each sample separate from each other in the gel is due to Amplified target regions of four different samples were separated using gel electrophoresis. DNA fragments labeled a) the amount of P32 bonded to each fragment. b) the number of restriction sites in each fragment. c) the distance between the primer recognition sites. d) the number of positive charges in each fragment.