A frameshift mutation results in ___. errors in DNA splicing errors in DNA replication a change in all mRNA codons downstream from the mutations a normal protein due to the redundancy of the genetic code a change in the third position of one codon

A frameshift mutation results in ___. errors in DNA splicing errors in DNA replication a change in all mRNA codons downstream from the mutations a normal protein due to the redundancy of the genetic code a change in the third position of one codon

Name: A frameshift mutation results in ___. errors in DNA splicing errors in
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A frameshift mutation results in ___. errors in DNA splicing errors in DNA replication a change in all mRNA codons downstream from the mutations a normal protein due to the redundancy of the genetic code a change in the third position of one codon

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 4SQ: For each species, all ________ in the complete set of chromosomes is the ________. a. genomes;...

See similar textbooks

Similar questions

MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA -Answer/fill the blank circles provided in the image.
Please answer fast Give ans for each statement 1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state? a.The RNA polymerase does not correctly read the codon code on the mRNA. b.The protein is not being regulated properly. c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.
LABEL IMAGE WITH THESE TERMS TRANSCRIPTION DNA MRNA AND PROTEIN ALSO CIRCLE EACH CODON
Enhanced Spatial Learning Ability in Mice Engineered to Carry an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory. Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451. In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability. Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface or a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platforms location by checking visual cues around the edge or the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some or Tabuchis result. FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3 (R451C) were tested for learning performance: as compared with unmodified (wild-type) mice. Did the modified or the unmodified mice learn the location of the platform faster in the first test?
For each species, all ________ in the complete set of chromosomes is the ________. a. genomes; library b. DNA; genome c. mRNA; start of cDNA d. cDNA; start of mRNA
Enhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 2. Did the modified or the unmodified mice learn the location of the platform faster in the first test?
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.
If you’re a eukaryote, why can’t you have a mutation rate as high as RNA viruses?
A mutation occurs within a gene sequence but no change is detected in the amino acid sequence. What is the most likely explanation? Mutation occurred in the exon which is spliced out Mutation occurred in the third nucleotide of a codon Mutation occurred in the second nucleotide of a codon Mutation occurred in the first nucleotide of a codon
Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T G G This would be an example of which type of a point mutation?__________________________
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…