Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write DNA–>RNA–>protein in the center of your page. Add the essential terms (objects and processes) on the post class pages for replication, transcription and translation. Link (connect) these terms with very short active phrases. i.e. binds to, makes a copy of, are made of.

Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write DNA–>RNA–>protein in the center of your page. Add the essential terms (objects and processes) on the post class pages for replication, transcription and translation. Link (connect) these terms with very short active phrases. i.e. binds to, makes a copy of, are made of.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 19P: Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite...

See similar textbooks

Similar questions

Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write DNA–>RNA–>protein in the center of your page. Add the essential terms (objects and processes) on the post class pages for replication, transcription and translation.
Describe the critical role that complementary base-pairing plays in replication, transcription, and translation.
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
. How does the double helix structure of DNA support itsrole in encoding the genome?a. The sugar-phosphate backbone provides a templatefor DNA replication.b. tRNA pairing with the template strand createsproteins encoded by the genome.c. Complementary base pairing creates a very stablestructure.d. Complementary base pairing allows for easyediting of both strands of DNA.
Pick either one of the following to answer: 1) Transcription and translation both involve an initiation, elongation, and termination phase. Describe how each of these phases occurs for both transcription and translation. OR 2) Both transcription and translation involve modifications following the termination step. Describe these modifications and the importance of each modification to complete the final product.
Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
Give an example of a concrete situation, in the human body, which would lead to DNA replication and another example of a concrete situation, which would lead to transcription/translation of DNA
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Directions: Given the DNA strand below. Decode the hidden message in the proteins that will be produce in protein synthesis of the given DNA strand. Identify the (1) complimentary DNA strand, (2) mRNA, (3) tRNA, (4) amino acid sequence, and (5) protein. Use the 1-letter symbol of the amino acids to produced to decode the message.
Use the mRNA coding chart above to answer these questions. he following is the base sequence on a portion of a template strand of DNA. 3 ‘ TACGCCAGTGGTTCGCAC 5 Give the base sequence of the complementary DNA strand. Give the base sequence of the strand of mRNA read from the original DNA template strand. List, in order, the amino acids that would be present in this protein? What would be the code that the methionine tRNA anticodon would carry? Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T. i) How would this change the protein? ii) What type of mutation is this?