The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the complementary mRNA nucleotide monomers, b) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the anti-codons of tRNA, c) The interaction with the cell membrane, d) All of these e) None of these are correct

The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the complementary mRNA nucleotide monomers, b) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the anti-codons of tRNA, c) The interaction with the cell membrane, d) All of these e) None of these are correct

Name: The characteristic way in which the DNA molecule is copied to form mRN
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The characteristic way in which the DNA molecule is copied to form mRNA is most related to:a) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the complementary mRNA nucleotide monomers,b) the ability of RNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
Match the following with the correct nucleic acid. (mRNA, tRNA, rRNA, or All RNA) 1. This molecule is complementary to DNA. 2. This molecule is part of translation. 3. This molecule is part of the ribosome. 4. This molecule contains anticodons. 5. This molecule is esponsible for bringing amino acids to the ribosome. 6. DNA is used as a template to create this type of RNA molecule. 7. This molecule is part of transcription. 8. This molecule contains codons.
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
Which of the following are stages of translation? Select all that apply. ---A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. ---When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. ---As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. ---The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon. ---Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA.
Which of the following processes of genetic information flow can occur under lab conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)
The process of translation involves three distinct phases: initiation, elongation, and termination. Which of the following is an accurate statement of a molecular event that occurs during one of the phases? A. All phases of translation require the energy of ATP to fuel molecular processes. B. The first components to assemble in initiation are the large ribosomal subunit, mRNA, and the initiator tRNA molecule. C. A peptide bond forms between the new amino acid and the amino acid at the C-terminus of the growing polypeptide chain. D. Amino acids are added to the polypeptide chain that sits in the A site of the translation initiation complex.
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCA
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '
The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams. Which of the following might be one contributing factor to the function of rRNA based on comparisons between the structures of the three molecules? A - rRNA molecules are sufficiently flexible because they contain more RNA loops. B - rRNA molecules are more reactive because they have longer chains of unmatched bases. C - rRNA molecules are sufficiently stable because the sequence of bases allows for more internal hydrogen bonds. D - rRNA molecules are more rigid because they have a more regular sequence of bases than other RNA molecules.
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized? A) A-A-A-A-A; ribosome B) U-U-U-U-U; ribosome C) A-A-A-A-A; nucleus D) U-U-U-U-U; nucleus