A A A A A A 3' 5° MRNA Add a poly-dT primer that binds to the polyA tail of MRNA. 3'1 :5' тт A A A A A A 5° :3" Add reverse transcriptase + DNTPS to synthesize a complementary DNA strand. 3' :5' ттT A A A A A A 5° 3' Add RNaseH to cut up the RNA and generate RNA primers. 3' 5' Add DNA polymerase I and DNA ligase to synthesize the second DNA strand. 3' 5' ÄÄÄÄ Ä Ä ШШ 5" :3' Double-stranded CDNA FIGURE 21.3 Synthesis of cDNA. A poly-dT primer binds to the 3' end of eukaryotic mRNAs. Reverse transcriptase catalyzes the synthesis of a complementary DNA strand (CDNA). RNaseH digests the MRNA into short pieces that are used as primers by DNA polymerase I to synthesize the second DNA strand. The 5' to 3' exonuclease function of DNA polymerase I removes all of the RNA primers except the one at the 5' end (because there is no primer upstream from this site). This RNA primer can be removed by the subsequent addition of an RNase. After the double-stranded CDNA is made, it can then be inserted into a vector, as described in Figure 21.4b.

A A A A A A 3' 5° MRNA Add a poly-dT primer that binds to the polyA tail of MRNA. 3'1 :5' тт A A A A A A 5° :3" Add reverse transcriptase + DNTPS to synthesize a complementary DNA strand. 3' :5' ттT A A A A A A 5° 3' Add RNaseH to cut up the RNA and generate RNA primers. 3' 5' Add DNA polymerase I and DNA ligase to synthesize the second DNA strand. 3' 5' ÄÄÄÄ Ä Ä ШШ 5" :3' Double-stranded CDNA FIGURE 21.3 Synthesis of cDNA. A poly-dT primer binds to the 3' end of eukaryotic mRNAs. Reverse transcriptase catalyzes the synthesis of a complementary DNA strand (CDNA). RNaseH digests the MRNA into short pieces that are used as primers by DNA polymerase I to synthesize the second DNA strand. The 5' to 3' exonuclease function of DNA polymerase I removes all of the RNA primers except the one at the 5' end (because there is no primer upstream from this site). This RNA primer can be removed by the subsequent addition of an RNase. After the double-stranded CDNA is made, it can then be inserted into a vector, as described in Figure 21.4b.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?
Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two ATG’s. From which the translation can be initiated.i. 1st ATGii. 2nd ATGiii. Noneb) If there are multiple possible start codons, how can you identify the original start codon? Explain.
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
The DNA sequence below is from the center of a protein coding region. 5 10 15 20 25 30 5’ …… TATCC TAGAG CATAA TTTCG AGATA GCTAG …… 3’ 3’ …… ATAGG ATCTC GTATT AAAGC TCTAT CGATC …… 5’ a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant gene has GC (bold) to TA substitution @ position 20. c) What is the sequence of the mutant polypeptide d) What effect is the mutation likely to have on function of the protein? Explain with reasoning.
⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer:
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'