Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name EcoRI Recognition sequence and position of cut 5'GLAATTC3' 5 GIGATCC3 5'GIGTACC3' 5 GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3' ВатHI Асс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.

Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name EcoRI Recognition sequence and position of cut 5'GLAATTC3' 5 GIGATCC3 5'GIGTACC3' 5 GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3' ВатHI Асс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
Give the recognition sequences for each of the restriction enzymes (a) PagI, (b) AluI, (c) PstI, and (d) RcaI. Show the sequence in double-stranded DNA (dsDNA) format, indicate the cleavage position with a ^, and mention which types of ends are generated in each case (blunt or sticky; 5’ or 3’ overhang)? Recognition sequence for a)PagI cleaves DNA at the recognition sequence 5' ---T ^CATGA--- 3' b) AluI cleaves DNA at the recognition sequence 5' AG^CT 3' c) PstI cleaves DNA at the recog.
Choose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGA
Which of the following sequences, when combined with itscomplement, would be clipped by a restriction endonuclease?a. ATCGATCGTAGCTA b. AAGCTTCGAA c. GAATTC d. ACCATTGGA
The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
The total size of the plasmid is 2686 bp. There is a PstI recognition site at position 439, HindIII recognition site at position 447, and ScaI recognition site at 2179. If restriction enzymes ScaI and HindIII are used to cut this plasmid, what would be produced? a. 2 fragments: 954bp and 1732bp b. none of the choices apply c. 1 linear fragment of 2686bp d. 3 fragments: 447bp, 507bp and 1732bp
Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: (see image) a) This plasmid is digested with the enzymes listed below. Indicate how many fragments will begenerated in each case, and give the sizes of the fragments.PstIXhoICombination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. c) This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.
HindIII is a restriction endonuclease that recognizes a palindrome sequence. Predict which one is the HindIII recognition site: a. AAGGTT b. AAGCTT c. AGCCGA d. AGCGCA e. AGCAGC
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above