2a. The following is a single side of a strand of DNA. Write out (below the strand) the complimentary bases that would form a DNA strand that would bind to this one. ATG AAA CGC CCA CCA CCA TTT GAA GTT GCA CAT GGG TAG 2b. Now write the complimentary mRNA strand for the oriainal typed strand in 2a. AVC 2c. Write the complimentary tRNA strand for the strand you wrote in 2b. 2d. Using your tRNA strand in 2c, write (abbreviation is fine) the amino acids for each codon. Also state what these amino acid chains become Tyr Phe Ala Gly Gy Gly Lys Lco Glu His Val fro Iie yroire Phenylalanine - Alanire Glyane Glyare -Glyairg Lysne Leucire 2e. Show one or two mutations by writing the complimentary mRNA strand for the original typed DNA strand, and like above do the complimentary tRNA, and the amino acids. (repeating 2b & 2c with added mutations) [am acds] 2f. Compared to 2d, did your mutation(s) change an amino acid, change the number of amino acids, or do nothing? Note where your mutation(s) is/are 2g. How do mutations effect the final protein in organisms? (specifically when they occur in gametes)

2a. The following is a single side of a strand of DNA. Write out (below the strand) the complimentary bases that would form a DNA strand that would bind to this one. ATG AAA CGC CCA CCA CCA TTT GAA GTT GCA CAT GGG TAG 2b. Now write the complimentary mRNA strand for the oriainal typed strand in 2a. AVC 2c. Write the complimentary tRNA strand for the strand you wrote in 2b. 2d. Using your tRNA strand in 2c, write (abbreviation is fine) the amino acids for each codon. Also state what these amino acid chains become Tyr Phe Ala Gly Gy Gly Lys Lco Glu His Val fro Iie yroire Phenylalanine - Alanire Glyane Glyare -Glyairg Lysne Leucire 2e. Show one or two mutations by writing the complimentary mRNA strand for the original typed DNA strand, and like above do the complimentary tRNA, and the amino acids. (repeating 2b & 2c with added mutations) [am acds] 2f. Compared to 2d, did your mutation(s) change an amino acid, change the number of amino acids, or do nothing? Note where your mutation(s) is/are 2g. How do mutations effect the final protein in organisms? (specifically when they occur in gametes)

Name: In problem 2e, how can you identify added mutations? 2a. The following
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: In problem 2e, how can you identify added mutations? 2a. The following is a single side of a strand of DNA. Write out (below the strand) the complimentary bases thatwould form a DNA strand that would bind to this one.ATG AAA CGC CCA CCA CCA TTT GAA G

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) molecules
A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNA DNA information strand: 5’ AAC GTT CAA ACT GTC 3’
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!
Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the nucleotide sequence of the DNA strand complemantary to sequence given above B Give the sequence of nucleotide in the Mrna that would be synthesized if the complementary strand in the answer above is used as a template during transcription
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?