Question

In problem 2e, how can you identify added mutations?

2a. The following is a single side of a strand of DNA. Write out (below the strand) the complimentary bases that
would form a DNA strand that would bind to this one.
ATG AAA CGC CCA CCA CCA TTT GAA GTT GCA CAT GGG TAG
2b. Now write the complimentary mRNA strand for the oriainal typed strand in 2a.
AVC
2c. Write the complimentary tRNA strand for the strand you wrote in 2b.
2d. Using your tRNA strand in 2c, write (abbreviation is fine) the amino acids for each codon.
Also state what these amino acid chains become
Tyr Phe Ala Gly Gy Gly Lys Lco Glu His Val fro Iie
yroire Phenylalanine - Alanire Glyane Glyare -Glyairg Lysne Leucire
2e. Show one or two mutations by writing the complimentary mRNA strand for the original typed DNA strand,
and like above do the complimentary tRNA, and the amino acids. (repeating 2b & 2c with added mutations)
[am acds]
2f. Compared to 2d, did your mutation(s) change an amino acid, change the number of amino acids, or do
nothing? Note where your mutation(s) is/are
2g. How do mutations effect the final protein in organisms? (specifically when they occur in gametes)
expand button
Transcribed Image Text:2a. The following is a single side of a strand of DNA. Write out (below the strand) the complimentary bases that would form a DNA strand that would bind to this one. ATG AAA CGC CCA CCA CCA TTT GAA GTT GCA CAT GGG TAG 2b. Now write the complimentary mRNA strand for the oriainal typed strand in 2a. AVC 2c. Write the complimentary tRNA strand for the strand you wrote in 2b. 2d. Using your tRNA strand in 2c, write (abbreviation is fine) the amino acids for each codon. Also state what these amino acid chains become Tyr Phe Ala Gly Gy Gly Lys Lco Glu His Val fro Iie yroire Phenylalanine - Alanire Glyane Glyare -Glyairg Lysne Leucire 2e. Show one or two mutations by writing the complimentary mRNA strand for the original typed DNA strand, and like above do the complimentary tRNA, and the amino acids. (repeating 2b & 2c with added mutations) [am acds] 2f. Compared to 2d, did your mutation(s) change an amino acid, change the number of amino acids, or do nothing? Note where your mutation(s) is/are 2g. How do mutations effect the final protein in organisms? (specifically when they occur in gametes)
Expert Solution

Want to see the full answer?

Check out a sample Q&A here
Blurred answer
Students who’ve seen this question also like:
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
Not helpful? See similar books
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
The Human Body: An Orientation. 1RQ
marketing sidebar icon
Want to see this answer and more?
Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*
*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.

Related Biology Q&A

Find answers to questions asked by students like you.

Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- Conversion of DNA into protein involves two processes :- Transcription :- It is the…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…

A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…

Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…

Q: A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: A.  1. Create the complementary strand for the DNA strand below. Make sure to label the parts and…

Q: 1. Fill in the parent and template strands of DNA below. Next transcribe the RNA from the template…

A: Click to see the answer

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A: Click to see the answer

Q: I’m supposed to translate tRNA into amino acids for each codon of the previous question and state…

A: Hi. After accepting the question, I see that you have incorrectly solved 2b and 2c. I am giving you…

Q: 1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an…

A: DNA replication is critical because cell division would be impossible without it. The set of DNA of…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: 4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide…

A: Transcription is the DNA dependent RNA synthesis. Process of transcription is catalyzed by RNA…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: The table opposite shows the standard (coding strand) DNA triplet codes for the 20 amino acids…

A: The central dogma is the process of making functional product that is the protein from the…

Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…

A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…

Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…

A: Click to see the answer

Q: A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the…

A: A nucleotide is the monomer that forms the polynucleotide strand which forms either a DNA or a RNA…

Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, sugar and nitrogenous…

A: It is important to understand the structure of the DNA molecule as it contains all the instruction…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: 2. Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…

A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA   1. In…

A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…

Q: Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments…

A: Agarose gel electrophoresis is one the technique used in Recombinant DNA Technology and Molecular…

Q: 25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are molecular scissors that are used in recombinant DNA technology to cut DNA at…

Q: 1.This is responsible for breaking hydrogen bonds between complementary nucleotides of a DNA duplex…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the  coding strand is     5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: Nucleic acid is a long chainlike molecule composed of nucleotides found in cells of all living…

Q: v pulls a portion of the DNA strands apart from other, exposing unattached DNA bases each A. 3rd…

A: Transcription is the process by which the information of the genes are passed from DNA to RNA…

Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…

A: Click to see the answer

Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3'    Write the sequence of the DNA…

A: The central dogma of life involves three processes. They are: Replication: In this process, copies…

Q: a) Complete the table below. Assume that reading is from left to right and that the columns…

A: In molecular biology central dogma is the mechanism which takes place from the DNA(hereditary unit…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Q: 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’ Complementary DNA sequence:…

A: Replication is the process of formation of identical copies of DNA. It occurs in nucleus.…

Q: A DNA antisense strand contains the following ucleotide base sequence CGA TIT GGT TGA 37. From thin,…

A: Click to see the answer

Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…

A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…

Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…

A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: The use of dideoxynucleotide triphosphates in the Sanger method facilitates sequencing of…

A: DNA sequencing is the technique of determining the sequence of individual nucleotides in a gene or…

Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…

A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…

Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…

A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…

Q: 8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is a genetic…

Q: 1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP…

A: AP endonuclease : It is an enzyme which is involved in the DNA base excision pathway The main…

Q: After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to. .…

A: It is a cotton cloth that is loosely woven and resembles gauze.

Q: DNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are…

A: DNA, deoxyribonucleic acid is a double helical molecule present in the cell which carries genetic…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…

Knowledge Booster
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Recommended textbooks for you
  • Human Anatomy & Physiology (11th Edition)
    Biology
    ISBN:9780134580999
    Author:Elaine N. Marieb, Katja N. Hoehn
    Publisher:PEARSON
    Biology 2e
    Biology
    ISBN:9781947172517
    Author:Matthew Douglas, Jung Choi, Mary Ann Clark
    Publisher:OpenStax
    Anatomy & Physiology
    Biology
    ISBN:9781259398629
    Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
    Publisher:Mcgraw Hill Education,
  • Molecular Biology of the Cell (Sixth Edition)
    Biology
    ISBN:9780815344322
    Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
    Publisher:W. W. Norton & Company
    Laboratory Manual For Human Anatomy & Physiology
    Biology
    ISBN:9781260159363
    Author:Martin, Terry R., Prentice-craver, Cynthia
    Publisher:McGraw-Hill Publishing Co.
    Inquiry Into Life (16th Edition)
    Biology
    ISBN:9781260231700
    Author:Sylvia S. Mader, Michael Windelspecht
    Publisher:McGraw Hill Education
  • Human Anatomy & Physiology (11th Edition)
    Biology
    ISBN:9780134580999
    Author:Elaine N. Marieb, Katja N. Hoehn
    Publisher:PEARSON
    Biology 2e
    Biology
    ISBN:9781947172517
    Author:Matthew Douglas, Jung Choi, Mary Ann Clark
    Publisher:OpenStax
    Anatomy & Physiology
    Biology
    ISBN:9781259398629
    Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
    Publisher:Mcgraw Hill Education,
    Molecular Biology of the Cell (Sixth Edition)
    Biology
    ISBN:9780815344322
    Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
    Publisher:W. W. Norton & Company
    Laboratory Manual For Human Anatomy & Physiology
    Biology
    ISBN:9781260159363
    Author:Martin, Terry R., Prentice-craver, Cynthia
    Publisher:McGraw-Hill Publishing Co.
    Inquiry Into Life (16th Edition)
    Biology
    ISBN:9781260231700
    Author:Sylvia S. Mader, Michael Windelspecht
    Publisher:McGraw Hill Education