For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the mRNA codon should be: O a. TTT O b. UUU О с. ААА O d. either UAA or TAA, depending on first base wobble O e. UUA

For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the mRNA codon should be: O a. TTT O b. UUU О с. ААА O d. either UAA or TAA, depending on first base wobble O e. UUA

Name: For a TTT triplet of bases in the template sequence of DNA, the antic
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the MRNAcodon should be:O a. TTTO b. UUUO C. AAAO d. either UAA or TAA, depending on first base wobbleO e. UUA

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT
Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:
If we watched a eukaryotic cell initiate translation, one of the first things we would see is a. The small ribosomal subunit binding to the cap b. The formation of the 70s initiation complex c. The small ribosomal subunit binding to the Shine-Dalgarno sequence d. The formation of the 80s initiation complex
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomes
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?