A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNAfragment, and set up a series of four dideoxy reaction. You then separate the products of thereaction by gel electrophoresis and obtain the following banding patter:ddATPddTTPddCTPddGTPWhat is the base sequence of the original fragment that you were given?5'-TAAGCTGA-3'O 5'-ATTCGACT-3'O 5'-TCAGCTTA-3'O 5'-AGTCGAAT-3'

While deciphering a sequencing gel, we know that it depends on terminating the reaction at 3' end…

Answered: A piece of DNA fragment is sequenced.…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 only
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
What is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if it was formed using the following template DNA segments? 3′ AATGC 5′ 5′ AATGC 3′ 3′ GCAGC 5′ 5′ GCAGC 3′
The following gel was produced in manual DNA sequencing. What would the unknown DNA template be that this gel represents?
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
the restriction enzyme NotI recognizes the following sequence : 5'-GCGGCCGC-3' . On average, how oftern should this enzyme cleave DNA?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

SEE MORE TEXTBOOKS