A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] . That enzyme also [ Select ] The leading strand would be the [ Select ] . Helicase is a(n) [ Select ] In this picture, helicase would be moving in the [ Select ] direction. 3' > >

A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] . That enzyme also [ Select ] The leading strand would be the [ Select ] . Helicase is a(n) [ Select ] In this picture, helicase would be moving in the [ Select ] direction. 3' > >

Name: A replication fork is shown below. The primary enzyme that catalyzes
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A replication fork is shown below. The primary enzyme that catalyzes replicationis [ Select ]. That enzyme also[ Select ]The leading strand would be the[ Select ]. Helicase is a(n) [ Select ]In this picture, helicase would be moving in the [ Select

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Draw a replication bubble with both replication forks and label the origin of replication, the leading strands, lagging strands, and the 5' and 3' ends of all strands shown in your diagram. Pls help asap!
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?
For the template DNA below, which includes one labeled end of the template DNA, clearly label the following: The origin of replication The most recently added base on each strand you draw for b & c, marked with an asterisk (star). Where DNA helicase would be & direction it moves. Where DNA ligase will be needed after replication is complete.
Draw a replication origin in E. coli. Place the first 4 primers in the figure. Show how the replication would proceed. Label polarity of ALL template and growing (newly synthesized) strands. Show direction of synthesis on all growing strands and identify all leading and lagging strands (I do not want you to mention or describe the enzymes involved). please give answer asap
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
. Draw a replication bubble with both replication forksand label the origin of replication, the leading strands,lagging strands, and the 5′and 3′ ends of all strandsshown in your diagram.
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
You figure out a way to replicate DNA in a test tube by adding double-stranded DNA template, dNTPs, NTPs and all the proteins needed for replication. However, you forget to add DNA ligase. In a well-labelled diagram, fill in the following parts of the growing replication fork shown. 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)
If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)