A significant number of mutations in the HBB gene that cause human b@thalassemia occur within introns or in upstream noncoding sequences. Explain why mutations in these regions often lead to severe disease, although they may not directly alter the coding regions of the gene.

Q: Two missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form…

A: According to the question, we have to mention the codons which are responsible for the…

Q: What sequence elements are found within the core promoter of protein-encoding genes in eukaryotes?…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins.…

Q: Certain repeated sequences in eukaryotes are flanked by short direct repeats, suggesting that they…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Introns in eukaryotic protein-coding genes are rarely shorter than 65 nucleotides in length. What…

A: In eukaryotes the template strand of DNA gets transcribed into pre-mRNA by the process known as…

Q: The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…

A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: Another class of suppressor mutations, not describedin the chapter, are mutations that suppress…

A: A missense mutation is a type of mutation in which the error occurs in a single base. It is also…

Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…

A: Gene expression is a process by which genetic information from a gene is used for the production of…

Q: A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that…

A: The normal mRNA is 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ The bases in bold form the start codon.…

Q: A nonsense mutation is a substitution mutation that creates a chain-terminating codon in the mRNA…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT…

A: The CAAT box is popularly known as a core promoter or basal promoter or simply the  Promoter. It is…

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are  primer widely used for cDNA the synthesis generation of a high frequency of…

Q: Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost…

A: Transcription is the first step in central dogma of protein synthesis. It involves formation of…

Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…

A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…

Q: one promoter can regulate the expression of different polypeptides (proteins) in both prokaryotes…

A: Promoter sequences are DNA sequences that define where transcription of a gene by RNA polymerase…

Q: A nonsense mutation occurs in the AB sequence. What would be the most significant outcome of this?

A: Metabolic pathways- Metabolic pathway is a linked series of chemical reactions occurring within a…

Q: Geneticists often use ethylmethane sulfonate (EMS) to induce mutations in Drosophila. Why is EMS a…

A: Ethylmethane sulfonate (EMS) : It is a mutagenic, teratogenic and possibly carcinogenic organic…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how…

A: The pre-mRNA is composed of two regions, one is the intron, and the other is the exon. The…

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: Although a large number of mutagenic chemicals are known,none is known that induces mutations in…

A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…

Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…

A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…

Q: mutant appear on a gel in comparison

A: Point mutations can cause serious changes to an organism if they change the way a protein works By…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: Eucaryotic

A: Introduction:-  Heterogeneous nuclear RNA or hn RNA is a term that encompasses various types and…

Q: A significant number of mutations in the HBB gene that causehuman β thalassemia occur within introns…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…

A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…

Q: If you sampled a patient with the autosomal recessive disease Tay Sachs and found she had normal…

A: Tay-Sachs is an autosomal recessive central nervous disorder. The disorder results from…

Q: An investigator was interested in studying UAG nonsense suppressor mutations in bacteria. In one…

A: If more than one gene encoded the same molecule become mutated, then the mutation in one of these…

Q: If a nonsense mutation can be suppressed by a tRNA mutation that changes an anticodon so that a…

A: Mutations are defined by any changes in the original DNA sequence caused due to insertions,…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Nonsense mutations occur when a premature nonsense or stop codon is introduced in the DNA sequence.…

Q: In bacteria, a transcription experiment in vitro with purified RNA polymerase holoenzyme is fairly…

A: Bacteria are one of the type of biological cell. They constitute a large domain of the  prokaryotic…

Q: Identify the DNA elements and protein factors, #1- 7, in the figure below that are involved in the…

A: Central Dogma =  According to the central DNA is converted to RNA (transcription) and RNA to protein…

Q: While miRNA response elements (MREs) may be located anywhere within an mRNA, they are most often…

A: Micro-RNAs are defined as a class or group of non-coding RNAs that will play an essential role in…

Q: Retrotransposons are a class of mobile elements that transpose via an RNA intermediate. Contrast the…

A: On the basis of  their manner of mobilization, DNA transposons have the ability to move by making…

Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…

A: The nucleotides in RNA (ribonucleic acid) or DNA (deoxyribonucleic acid) sequence are read as…

Q: In E. coli, a methyltransferase enzyme encoded by the dam generecognizes the sequence 5′–GATC–3′ and…

A: To explain: Why E. coli strains that have the DAM gene deleted are known to have a higher…

Q: A rare genetic disorder affecting the degradation of hemoglobin made a man suffer extreme…

A: Sangers method is a DNA sequencing method and is also known as enzymatic chain termination method.…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…

A: The coding sequence of the Gene F and G are given as                                        5'…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…

Q: Explain the Mutations at the Huntington disease locus are caused by an expansion of a trinucleotide…

A: Huntington’s disease is a brain disorder that is inherited in an autosomal dominant pattern. It is…

Q: The human insulin gene contains a number of sequences that are removed in the processing of the mRNA…

A: Insulin is a hormone released by beta cells of the islets of Langerhans of the pancreas. This…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.