Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS- KAPTKKPKATPVKKAKKKLAATPKKAKKPKTVKAPVKASKPKKAKPVK” Please propose pathway the degradation of this protein.
Q: If the following truncated peptide represents the active domain of the COVID19’s S-protein…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…
A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…
Q: A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that…
A: The normal mRNA is 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ The bases in bold form the start codon.…
Q: The gene for triose phosphate isomerase in maize (a corn plant) spans over 3400 base pairs of DNA…
A: The post-transcriptional modifications are observed during the processing of other transcripts which…
Q: . true or false a) Capping is the process of adding poly-guanido methyl in the mRNA. (true/false)…
A: Ans a.) Capping is the process of adding poly-guanido methyl in the mRNA. True # It is a kind of…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:
A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.
Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…
A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…
Q: 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries…
A: 5) To calculate molecular weight (KiloDalton [kD]) and the calculated pI of the protein, submit the…
Q: A mutation occurred on the lacI (repressor) gene resulting in a constant production of…
A: Genes are the functional segments of DNA. The cluster of these functional segments called genes is…
Q: In response to potentially toxic substances (e.g., high levels of iron), eukaryotic cells often use…
A: Post-transcriptional modifications of pre-mRNA molecules like capping, splicing, and…
Q: Lactose intolerant individuals do not produce the enzyme lactase. Studies show that the gene that…
A: Lactose sugar is obtained from milk products and milk. When people do not produce enough lactase…
Q: Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes…
A: Cancer Cancer if a kind of disorder which caused by several means like drug, radiation, malfunction…
Q: Arginine is one of the amino acids that serves as a building block for protein synthesis. Arginine…
A: Arginine is one of the amino acids that serves as a building block for protein synthesis. Arginine…
Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced.Gcn4…
A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…
Q: Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency…
A: Since we answer only three subparts of a question at a time, therefore we are answering the first…
Q: Explain how can you study protein Z components? (needed)
A: The proteins are the macromolecules and these structures are so so small that they can be seen by a…
Q: A significant number of mutations in the HBB gene that cause human b@thalassemia occur within…
A: Introduction: HBB is also known as beta-globin, hemoglobin, etc. It is a globin protein encoded by…
Q: How would the following affect BOTH transcription and translation of a particular multi- exon gene…
A: Transcription and translation are two distinct processes that allow the expression of a gene.…
Q: Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5%…
A: Non-sense mediated mRNA decay (NMD) is a technique evolved by the eukaryotic cells to prevent the…
Q: How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the…
A: Kanamycin inactivation :-
Q: Translational control is usually aimed at preventing the initiation of translation. With regard to…
A: The process of translating the sequence of mRNA into an amino acid sequence is called translation.…
Q: You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a…
A: In case of third experiment, both SRP (signal recognition particle) and endoplasmic reticulum…
Q: A significant number of mutations in the HBB gene that causehuman β thalassemia occur within introns…
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…
Q: Messenger RNA molecules are very difficult to isolate in bacteria because they are rather quickly…
A: RNA is constituded of ribose units, which have a highly reactive hydroxyl group on C2. This Hydoxyl…
Q: The tumor suppressor pRB also binds to and suppresses the activity of retinoblastoma-binding protein…
A: Mutation in genes is the process of change in the nucleotide sequence of the genome.
Q: A particular type of anemia in humans, called b-thalassemia,results from a severe reduction or…
A: A disease is a state of unhealthiness of the physical body, mind and social interaction. A disease…
Q: Under normal physiological conditions, proto-oncogenes and tumor suppressors help control cell…
A: A significant contrast among the oncogenes and tumor suppressor genes is that oncogenes result from…
Q: Examination of the histone modifications of a gene reveals an abundance of histone H3 with lysine 27…
A: This gene is likely activated since the mono-methylation of the lysine residue at position 27 in…
Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…
A: Nonsense mutations occur when a premature nonsense or stop codon is introduced in the DNA sequence.…
Q: Renata enzymatically conjugates a l"C-labeled cysteine to a transfer RNA (TRNA), with a UGU…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: embryos are exposed to this drug during an early stage of organogenesis, they develop severe…
A: Hox genes are involved in embryonic development as well as in mechanisms in the adult body , thus it…
Q: Unlike linker DNA and deproteinized DNA, DNA segments wrapped around histone cores are relatively…
A: Nuclease can digest nucleic acid.
Q: Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins.What would…
A: Endomembrane system: - it is a system through which the cell modifies, packages and transports the…
Q: While miRNA response elements (MREs) may be located anywhere within an mRNA, they are most often…
A: Micro-RNAs are defined as a class or group of non-coding RNAs that will play an essential role in…
Q: Tumor cells from a person with leukemia have been analyzed to determine which oncogene is involved…
A: Receptors are proteins which can be present in the cell membrane or in the nucleus. There are three…
Q: A rare genetic disorder affecting the degradation of hemoglobin made a man suffer extreme…
A: Sangers method is a DNA sequencing method and is also known as enzymatic chain termination method.…
Q: The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor…
A: JASPAR is an open-access database of curated. It is a non-redundant transcription factor (TF) which…
Q: Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation…
A: mRNA is translated to form protein. mRNAs contain trinucleotides sequences that code for particular…
Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…
A:
Q: The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein…
A: The segments of the genetic material which helps in the expression of the characters are known as…
Q: The human insulin gene contains a number of sequences that are removed in the processing of the mRNA…
A: Insulin is a hormone released by beta cells of the islets of Langerhans of the pancreas. This…
Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…
A: The process of translation involves the synthesis of polypeptide chain and proceeds in three stages:…
Q: Hemophilia in the royal family was caused by the presence of a mutation in the gene for factor IX…
A: Inheritance or heredity is passing-on one trait form the parents to the progeny by either asexual or…
Q: There is Hyaluronic acid synthesis occuring in Group X Strep and it is controlled by an operon with…
A: has operon Hyaluronic acid synthesis operon is an operon system that is required for synthesizing…
Q: MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene.…
A: DNA (deoxyribonucleic acid) is a double stranded molecule. One strand present in the 5’ to 3’…
Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS- KAPTKKPKATPVKKAKKKLAATPKKAKKPKTVKAPVKASKPKKAKPVK” Please propose pathway the degradation of this protein.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules are required for translation of proteins within mitochondria. Explain.Unlike linker DNA and deproteinized DNA, DNA segments wrapped around histone cores are relatively resistant to the hydrolytic actions of nucleases. Explain.The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?
- The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your research team. You have identified a new alternate allele of the sequence 5' AUG AAG CAG GGA UAA 3'. What type of mutation does this alternate sequence illustrate?MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
- Both ADA-SCID and type I diabetes are diseases based on lack of a particular protein. Why has the pioneering work on gene therapy focused on SCID instead of on diabetes?Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairHow many ATP and GTP molecules would be hydrolyzed in the synthesis of a 125 amino acid protein? Explain why this is a good argument for careful regulation of gene expression (especially considering that most proteins are larger than 125 amino acids).
- Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes (including many cancer-causing genes). Scientists determine that the histones from the cancer cells have an overall/average lower affinity for DNA than histones from normal control cells. Which drug is most likely to help treat this patient's cancer? a. An inhibitor for HMT (histone methyltransferases) b. An inhibitor for HDM (histone demethylases) c. An inhibitor for HDACs (histone deacetylases) d. An inhibitor for HATs (histone acetyltransferase)Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein? Why or why not?
