a. RNA Polymerase b. DNA Polymerase I h. Primers i. Aminoacyl synthetase j. Gyrase c. DNA Polymerase III d. Single Strand binding protein e. Sigma Factor f. Ligase g. Peptidyl transferase k. Release factors I. Rho factors m. AUG-fmet n. Initiation Factors Identify the following: 1. Catalyzes peptide bond formation between amino acids 2. Binds the amino acid to tis corresponding RNA 3. Recognizes terminator region 4. Relaxes the tension created by the unwinding process. 5. Complements DNA nucleotides with RNA nucleotides. 6. Complements DNA nucleotides with deoxynucleotide triphosphates. 7. Recognizes UAA, UAG, UGA

Q: 1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of…

A: the answers to these multiple-choice questions are given below.

Q: Transposase protein cana. bind to DNA.b. catalyze the excision of a transposable element froma donor…

A: Introduction: Transposons are a region or DNA segment that possess the ability to replicate on its…

Q: DNA synthesis has a very low error rate.  One reason for this is that the DNA polymerase enzyme can…

A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…

Q: During retrotransposițion of a short interspersednuclear element (SINE), nicking the target site DNA…

A: A complete genetic material present in an organism is referred to as a genome. Deoxyribonucleic acid…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: DNA is doubled stranded and has two strands - a template and a coding strand. Here, given a template…

Q: During DNA replication, short RNA primers are made by the Primase. Why?   a. To provide a 3'-OH so…

A: DNA replication is the process through which cells make copies of the genome's DNA. A cell must…

Q: Protein Domain Mutations A) abasic nt endonuclease DNA-binding domain B) DNA gyrase C) DNA helicase…

A: Introduction: Insertion or deletion of one or two base pairs/ bases changes the reading frame. Such…

Q: How does the Cas9 endonuclease bind to specific sequences of DNA in order to make cuts?   A.  It…

A: Cas9 is a 160-kilodalton protein that plays a key part in certain bacteria's immunological defence…

Q: E. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V tends to…

A: DNA polymerase is an enzyme, which helps to synthesize new complementary strands with the…

Q: Find some unclear points in the "initial transcription by RNA polymerase proceeds through a DNA-…

A: Introduction :- Gene expression involves the different set of molecular processes :- replication ,…

Q: B. Both involve binding of rho, but rho-independent termination requires conformational change on…

A: After binding to the newly formed RNA chain, ρ factor moves along the molecule in a 5'-3' direction…

Q: III. DOUBLE MATCHING TYPE choose the enzyme/protein/requirement in Column A, and the…

A:

Q: Which of the following is/are true regarding the enzyme primase?  a: primase functions during…

A: DNA replication occurring in all organisms is the process of producing identical copies of DNA from…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: Eukaryotes such as humans have linear chromosomes. In order to signal the end of DNA replication,…

A: Telomere is a stretch of repeating DNA sequences that is found at the end of each chromosome.…

Q: Identify the Mutations 1. Original Strand Mutant Strand GGGCTAGGGCCAA GGGGCTAGGGCCAA Types of…

A: Mutations are the gradual changes that occur in our DNA  sequence because of several factors such as…

Q: Describe an experimental approach to determining the processivity of a DNA polymerase (i.e., the…

A: Processivity is the average number of bases a polymerase enzyme will extend and incorporate base…

Q: Put these events in chronological order and explain why (i.e. each process listed).   Sigma factor…

A: Transcription is a process of formation of mRNA from DNA. This process is done with the help of RNA…

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: A transcription unit is a stretch of DNA that codes for RNA.

Q: 9. Using your knowledge of DNA repair pathways, choose the pathway that would be used to repair the…

A: DNA repair pathways are a set of processes by which cell defines and corrects the damage to DNA that…

Q: identify the type of DNA binding motif is shown and the characteristics.

A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…

Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: Which of the following DNA repair pathways repair DNA double strand breakage that only occur in…

A: DNA repair is a method by which a cell maintains its genetic code in its original and unaltered…

Q: The effect that allolactose has on LacI is a. causing it to block binding of the CAP protein. b.…

A: Operons are clusters of genes in prokaryotes which are under the regulation of the same promoter…

Q: 29/ 50 Which of the following sms matched A Splicing: Eukaryotic premRNA B Lagging strand Okazaki…

A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: You are studying a colony of cells and determine that some of these cells have a mutated DNA…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: Explain how DNA polymerase and topoisomerase 2 contribute to replication in E.coli and what is the…

A: It is principally selected to replication-obstructing DNA sores (lesions) to combine the early…

Q: For each DNA repair process in column I, list all characteristics fromcolumn II that correctly…

A: Although genetic variation are important for evolution, the survival of the individual demands…

Q: Mutation of subunit epsilon (ɛ) of DNA polymerase II will result in an E. coli strain that has a…

A: Question -Mutation of subunit epsilon (ε ) of DNA polymerase lll will result in an E. coli strain…

Q: Which proteins are responsible for the unwinding of the double-stranded DNA during  relication?…

A: DNA replication is a process in which DNA strands are copied into their complementary DNA strands.

Q: RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:…

A: RNA polymerase enzyme is a multi subunit enzyme having a catalytically active core.

Q: A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Identify the three protein complexes/enzymes important in eukaryotic DNA replication A. Enhancer,…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: n bacterial RNA polymerase, the sigma factor A. contains the catalytic activity of the polymerase…

A: RNA polymerase is a transcription enzyme that copies a DNA sequence into RNA. RNA polymerase…

Q: It is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA…

A: Introduction  DNA replication is very crucial for the continuation of life as every new daughter…

Q: The DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells.…

A: DNA synthesis is a semiconservative process in both eukaryotes and prokaryotes. This means that each…

Q: Can you please answer question 33 and 36

A:

Q: Which of the following types of mutations are advantageous to cancer cell growth? a. Those…

A: DNA is the genetic material present in the genome of organisms.

Q: Which of the following statements are true regarding the properties of DNA and RNA polymerase.…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: You have used the technique of chromatin immunoprecipitation to isolate DNA fragments containing a…

A: In chromatin immunoprecipitation assay (ChIP) first tissue or cells are fixed with the help of…

Q: Okazaki fragments are ________.   A. short RNA primers needed for initiation of polymerization…

A: Okazaki fragments are the short and newly synthsizes DNA sequnces. They are important for DNA…

Q: Define and indicate the significance of (a) Okazaki fragments,(b) DNA ligase, and (c) primer RNA…

A: Introduction  DNA replication is very crucial for the continuation of life as every new daughter…

Q: Once bound to the promoter, RNA polymerase Oa. melts the two DNA strands in the termination site…

A: RNA polymerase  It is an enzyme that is used to copy the DNA strand into RNA.

Q: The short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by…

A: Replication is the process of synthesis of daughter stand from the parental strand by the action of…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift…

A: A frameshift mutation is a type of mutation that involves the insertion or deletion of nucleotides…

Q: After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…

A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…

Q: 1) Which of the following complexes contributes to the transcription of cyclin E? a) Cdk1/cyclin A…

A: 1) The cell cycle is a sequence of events that is occurring in a ordered fashion which results in…

Q: A fragment of DNA has the sequence 5'-ATCCGCT-3'. Following DNA replication, the complementary…

A: Introduction Mutation is defined as the changes in the genetic material of an organism. Mutation can…