During retrotransposițion of a short interspersednuclear element (SINE), nicking the target site DNA involves activity. O d. Endonuclease O b. Target site nicking c. DNA Nickase e. Exonuclease a. Reverse transcriptase
Q: The linking of the 5’ end of one Okazaki fragment with the 3’ end of an adjacent Okazaki fragment…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: The following sequence of nucleotides is found in a single-stranded DNA…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…
A: DNA ligase is the enzyme connecting two DNA strands together. It does so by bonding the phosphate…
Q: Initiation of transcription requires: O Okazaki fragments. Oa DNA primer. O an RNA primer. O DNA…
A: Need to find which is required for initiation of transcription from the following options.
Q: The restriction enzyme BamHI recognizes the sequence GGATCC and cuts the DNA between the two G’s.…
A: Ans: Restriction enzymes: The enzymes which cuts the DNA at specific site and used in cloning is…
Q: The function of transposase isa. to recognize inverted repeats.b. to remove a TE from its original…
A: A gene is a specific sequence of nucleotides in RNA or DNA that is located usually on a chromosome.…
Q: In gene silencing, the “dicer” enzymea. assembles siRNAs into a RISC complex.b. unwinds the RISC…
A: Introduction: Gene silencing is a mechanism to regulate the expression of genes. The gene silencing…
Q: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts…
A: DNA helicase is used during the DNA replication process where it binds to the double-stranded DNA…
Q: Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA primer…
A: DNA synthesis is a complicated process and it is a semi conservative method. The main enzyme for the…
Q: Match up the DNA mutation with its description: Silent a. a point mutation where one amino acid is…
A: Silent - g) a point mutation where the amino acid sequence are unchanged Missense mutation - a) a…
Q: Which of the following does not occur during telomerase extension of parental DNA? a. Translocation…
A: Introduction: Telomerase, an enzyme having RNA template, extends its ends by copying the RNA…
Q: In a sequencing reaction, the dATP was left out of the tube.What would be the result of this…
A: Polymerase chain reaction (PCR) is a technique broadly used to quickly make millions to billions of…
Q: With regard to transcriptional termination in eukaryotes, which model suggests that RNA polymerase…
A: After RNA polymerase II has transcribed the polyadenylation, which is the process of cleaving the 3’…
Q: a) Under normal conditions E. coli produces three DNA polymerases. State their functional…
A: E.coli bacteria are considered prokaryotes, and the prokaryotes exhibit three different types of DNA…
Q: single DNA molecule contains two specific target sites separated by an intervening sequence. If…
A: *Here A single DNA molecule contains two specific target sites and they are separated by an…
Q: In E. coli, RecBCD complex has (select all correct answers) endonuclease activity а. O b. DNA…
A: RecBCD is a enzyme of e.coli which is required to repair thier DNA. RecBCD has many components and…
Q: The dideoxynucleosides ddATP, ddTTP, ddGTP, and ddCTP were important in DNA sequencing because they…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors used in the Sanger technique of…
Q: Original strand: G G G C T A G G G C C A A , Mutant strand: G G G G C T A G G G C C A A . What type…
A: According to our guideline we can answer only the first three subparts of a question. So, please…
Q: Describe an experimental approach to determining the processivity of a DNA polymerase (i.e., the…
A: Processivity is the average number of bases a polymerase enzyme will extend and incorporate base…
Q: the target DNA
A: CRISPR: It stands for Clustered Regularly Interspaced Short Palindromic Repeats. These are the…
Q: Figure 2 illustrates the important elements of a cosmid. a) Briefly describe the importance of…
A: In the recombinant DNA technology the foreign DNA or target DNA is inserted into the vector then the…
Q: he 3'____> 5' exonuclease activity of E. coli DNA polymerase III aacounts for the ____________ of…
A: This is the enzyme complex that is primarily involved in DNA replication with the aid of four other…
Q: Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon…
A: DNA provides mutagenic bases hypoxanthine and uracil when deaminated by adenine and cytosine…
Q: If primase makes an error and incorporates an incorrect base in the nucleic acid primer, then why…
A: An incorrect base will not pair correctly with the template strand. Its greater structural…
Q: You are studying a colony of cells and determine that some of these cells have a mutated DNA…
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: catalyzes the cleavage of DNA at a specific ii fragments. The statement given above is completed…
A: Enzymes are catalysts or the molecule, which are reaction specific. DNA ligase, DNA polymerase,…
Q: Which of the following is FALSE about "classic" transposons and retrotransposons? Ac is an…
A: Barbara McClintock discovered two classes of controlling elements in maize plant known as…
Q: A cDNA clone contains (a) introns (b) exons (c) anticodons (d) a and b (e) b and c
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: A restriction endonuclease, REI, recognize AAGCTT and cleaves between A and A in the sequence. Given…
A: Answer: RESTRICTION ENDONUCLEASE : It is the enzyme which is used to cut the DNA at specific sites…
Q: Addition or deletion of bases causes which kind of mutation? Select one: O a. Transversion O b. •…
A: Any heritable change that happens in the nucleotide sequence of the DNA is called a mutation.…
Q: Which proteins are responsible for the unwinding of the double-stranded DNA during relication?…
A: DNA replication is a process in which DNA strands are copied into their complementary DNA strands.
Q: It is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA…
A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…
Q: RNA polymerase unwinds the DNA forming the _________________________ (a) Okazaki fragment (b)…
A: Macromolecules are very large molecules commonly composed of the polymerization of smaller…
Q: The DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells.…
A: DNA synthesis is a semiconservative process in both eukaryotes and prokaryotes. This means that each…
Q: A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the…
A: A nucleotide is the monomer that forms the polynucleotide strand which forms either a DNA or a RNA…
Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: The basis for DNase I footprinting is that the binding of a proteinto DNAa. prevents the DNA from…
A: The DNase I footprinting is a crucial technique that is used to study the detailed interaction…
Q: At the DNA level, a mutation in a promoter region where six nucleotides are added. a) substitution…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: Define and indicate the significance of (a) Okazaki fragments,(b) DNA ligase, and (c) primer RNA…
A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…
Q: Once bound to the promoter, RNA polymerase Oa. melts the two DNA strands in the termination site…
A: RNA polymerase It is an enzyme that is used to copy the DNA strand into RNA.
Q: DNA polymerase III in bacteria is responsible for initiating DNA replication by adding nucleotides O…
A: Introduction:- Replication is a process by which a cell duplicates it's genetic material. There are…
Q: The short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by…
A: Replication is the process of synthesis of daughter stand from the parental strand by the action of…
Q: A certain mutant DNA polymerase is error-prone, tending to incorporate C opposite a template A. When…
A: Mutations in the DNA polymerase would affect the process of replication. It is studied under the…
Q: After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…
A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…
Q: a. RNA Polymerase b. DNA Polymerase I h. Primers i. Aminoacyl synthetase j. Gyrase c. DNA Polymerase…
A: The expression of the genetic material occurs generally through production of proteins. This…
Q: Explain why the active site of poly(A) polymerase is much narrower than that of DNA and RNA…
A: Poly (A) polymerase is the enzyme that is an important part of the polyadenylation machinery. It is…
Q: Chimeric DNA true are all except - a) Formed by linking DNA fragments of unrelated nis ood l nsvi…
A: Chimeric DNA is also known as recombinant DNA which is formed by linking DNA fragments of two…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In nucleotide excision repair in E. coli, the function of the UvrA/UvrB complex is toa. detect DNA damage.b. make cuts on both sides of the damage.c. remove the damaged piece of DNA.d. replace the damaged DNA with undamaged DNA.Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication forkFollowing a CRISPR mediated DNA double-strand break, how can the DNA be repaired by the cell? Choose all that apply. A. Base pairing between complementary sticky sides. B. Nonhomologous end joining. C. Homology directed repair. D. Crossing over between nonhomologous chromosomes.
- Match the E. coli mismatch repair enzyme on the left with the appropriate function on the right. MutS MutH MutL a. facilitates the looping of the region of DNA to be replaced b. distinguish between parental and newly-synthesized DNA c. locates mismatches in the DNAWhat would be the result if an organism’s telomerase were mutated and nonfunctional? a. No DNA replication would take place. b. The DNA polymerase enzyme would stall at the telomere. c. Chromosomes would shorten with each new generation. d. RNA primers could not be removed.Which of the following is true of reverse transcriptase?a. It is required for the movement of DNA transposons.b. It catalyzes the synthesis of DNA from RNA.c. It is required for the transposition of retrotransposons.d. b and c are correct.
- Place the steps of sanger sequencing in order.A. A fluorescent laser excites the fragments and records the wavelength consistent with a single nucleotide. B. ddNTPs bind and stop chain extension.C. DNA fragments are separated by size through a capillary tube. D. DNA polymerase copies the target region of template DNA.E. The final nucleotide of each fragment is labeled with a fluorescent tag.The activity of restriction enzymes may produce fragments with sticky ends. Sticky ends are a) a type of endonucleases. b) dephosphorylated CpG islands. c) unpaired nucleotides. d) double breaks with blunt ends.The function of a restriction enzyme is to a. prevent the movement of DNA outside the nucleus b. separate the DNA double helix c. cut the nucleotide sequence at a specific location in DNA d. proofread DNA for accidental damages and corrects these errors
- Topoisomerases are enzymes that can: a. join two DNA fragments to become one. b. catalyze conformational change of a protein. c. cut DNA at specific site. d. catalyze the breaking and rejoining of DNA strands which produces DNA that is either more or less superhelical than the original.Why do normal adult animal cells NOT express the telomerase enzyme? A) evolutionary accident B) prevent cancer C) increase the lifespan of the organism D) helps to replicate the chromosomesThe problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in one direction, is manifested inA. creation of primers every so often as more of the template strand isuntwisted.B. formation of shorter DNA strands called Okazaki fragments.C. the need for the enzyme ligase to link short DNA strands together.D. All of the above choices are correct.
