can you make this correct activity seems they are wrong pls answer correctly by following the instruction Name: Al-Raisalmill M. AlawiBSMT 2DSection:Directions:A. The insertion shifts the reading frame to the right .The deletion frameshifts thereading frame to the left. Insert a letter C for two insertion questions. For the deletionquestions, delete the H or one base letter.1. Write each codon perlineDNA sentence: THE BOY CUT HIS LIP AND ATE THE HOT DOGInsertion:THE BOY CCU THI SLI PAN DAT ATH EHO TDO.Deletion:THE BOY CUT ISL IPA NDA TẾT HEH OTDA.Write each codon per line and circle deleted letter and amino acidsOriginal DNA:TCA GCA CGA TCT CAG GAG CCT ATA ATCDeletion DNA UGU CGU GCU AGA GUC CUC GGA UAU UACMutate DNA: TCA GCA CGA TCT CAG GAG CCT ATA ATCMutated Amino acids: Met Pro Ala Arg Val Leu Gly Tyr STOPOriginal Amino Acids: Met Pro Ala Arg Val Leu Gly Tyr STOPA.Write each codon per line and circle the substituted letter and new amino acidsOriginal DNA: TAC GGA CGATCT CAG GAG CCT ATA ATCBase substituted DNA: AUG CCU GCU AGA GUC CỤC GGA UAU AUCMutated DNA TAC GGA CGA TCT CAG GAG CCT ATA ATC.Mutated Amino acids: Met Pro Arg Val Leu Gly Tyr STOPOriginal Amino Acids: Met Pro Arg Val Leu Gly Tyr STOP

Name: can you make this correct activity seems they are wrong pls answer cor
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: can you make this correct activity seems they are wrong pls answer correctly by following the instruction Name: Al-Raisalmill M. AlawiBSMT 2DSection:Directions:A. The insertion shifts the reading frame to the right .The deletion frameshifts thereadin

*NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Science

Biology

A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame to the left. Insert a letter C for two insertion questions. For the deletion questions, delete the H or one base letter. 1. Write each codon perline DNA sentence: THE BOY CUT HIS LIP AND ATE THE HOT DOG Insertion: THE BOY CCU THI SLI PAN DAT ATH EHO TDO. Deletion: THE BOY CUT ISL IPA NDA TET HEH OTD

A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame to the left. Insert a letter C for two insertion questions. For the deletion questions, delete the H or one base letter. 1. Write each codon perline DNA sentence: THE BOY CUT HIS LIP AND ATE THE HOT DOG Insertion: THE BOY CCU THI SLI PAN DAT ATH EHO TDO. Deletion: THE BOY CUT ISL IPA NDA TET HEH OTD

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 4P: Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair...

See similar textbooks

Similar questions

Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC Find start codon and stop codon UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).
Examine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGG
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Transcribe and translate the DNA strand Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
Mutations I used: stop codon, insertion, deletion and substitution. Explanation please.
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.
Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)