A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met

A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter31: Completing The Protein Life Cycle: Folding, Processing, And Degradation

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

1CFD CALCIUM-FREE CALMODULIN How long is the protein’s primary sequence?Does this protein have any secondary, tertiary and/or quaternary structures present?Are there any molecular additions to this protein that are not amino ac
1. Analysis of a peptide antibiotic purified from a strain of Bacillus brevii resulted in the following significant information: - Complete hydrolysis of the peptide yielded equimolar amounts of Leu, Orn, Phe, Pro, and Val - Molecular weight of the peptide was estimated to be aroung 1,200 Da - The peptide failed to undergo hydrolysis when treated with carboxypeptidase - Partial hydrolysis and then chromatographic separation of products yielded the following di- and tripeptides: Leu-Phe, Phe-Pro, Orn-Leu, Val-Orn, Val-Orn-Leu, Phe-Pro-Val, Pro-Val- - Orn Treament with dinitrofluorobenzene (DNFB) followed by complete hydrolysis yielded only free amino acids and the DNFB-derivatized ornithine at its side chain By using the above information, deduce the amino acid sequence of this peptide antibiotic. Write the final peptide sequence using 3-letter abbreviations. Show the complete and step by step solution.
Leu-Trp-Phe-Met-Ala-Ile-Val- Draw the structure of the peptide at pH7.4. and Indicate the hydrogen bonds formed in the alpha helix.
1.a.If this molecule was the side chain of an amino acid, in a protein, what tertiary structure stabilizers could be present? b.Make a key and use color to highlight what part of you structure can be stabilized in each manner?
1. In the separation of lysine from histidine using a sulfonated polystyrene column will it be easier to separate at pH 4 or pH 8 ? explain! 2. A peptide of the order Glx-Ala-Gly-Arg bound to a sulfonated polystyrene column at neutral pH. Is Glx Glu or Gln ? Explain !
1. In a protein, why does when Ala is replaced with Ile, it loses its activity but when Lys is replaced by Arg and Leu to Ile, it only has little effect on protein structure and function? Explain. 2. Why do proteins cannot be denatured reversibly when they are chemically altered to change the chemical composition of certain side chains? Explain.
4. Let’s build a polypeptide chain a. Using your arsenal of 4 amino acids, write out the primary structure of an 8 amino acid long polypeptide that you might be called amphipathic and thus allow it to form a micelle in aqueous solution, identify amino acid 1 through 8 as well as the location of the amino and carboxy termini of the polypeptide. b. Explain why this polypeptide would be considered amphipathic and draw what the micelle might look like in water. c. Taking amino acids 3, 4, and 5, draw the molecular structure of this particular stretch of polypeptide chain. Along the backbone linkage of the polypeptide identify the peptide bonds with a PB, the bonds with free rotation FR, and bonds with limited rotation LR.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.
Hydrogen bonds are usually 2.7-3.3 angstrom long. According to this information, do you think there is a direct hydrogen bonding between H840 and the phosphodiester bond that links dG13 and dT14 (Chain C)? If not, what is the key role of H840 in Cas9?
Chymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C-1 G-A-E-A-T-E C-2 G-K-V-G-A-H-A-G-E-Y C-3 V-L-S-P-A-K-T-N-V-K-A-A-W What is the sequence for the peptide? NOTE: Label the fragments when reconstructing the peptide chain e.g. for trypsin T-1, T-2 etc...
D. Draw the structure of Histidine and Imidazole. Why do you think we use Imidazole to elute the protein? Why do we use a 6X His tag?
9. H. State if/how Aureliano's mutation changes the amino acid sequence and describe the effect that change has, if any, on the protein.