Direction: Please answer letter B and email C thoroughly and explain your answer. Thank you so much. C. The following is the amino acid sequence for a smallsection of a protein: Methionine-phenylalanine-cysteine-glutamine-valine-tryptophan- isoleucine-proline-aspartate-serine-asparagine1. Find the mRNA triplets which code for thissequence.2. Use the mRNA to determine the DNA codon strand.3. Construct a complete double stranded DNAmolecule for this small protein.cdn.fbsbx.com B. Below is a short segment of a DNA molecule. Translatethe DNA codon into mRNA. Use your data sheet to findthe sequence of the amino acids coded for.TACCATGAGAATTGTGGTCACCTTΤΤΤΑΤGGTACTCTTAACACCAGTGGAAAA A1. mRNA:2. Amino Acid:3. If the nucleotide at position 23 in the first strand ofDNA ischanged to "A", what effect would this have on theprotein produced?

Transcription is the process of conversion of DNA to RNA, in this process the template strand is…

B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data sheet to find the sequence of the amino acids coded for. TACCATGAGAATTGTGGTCACCTT ΤΤΤΑΤ GGTACTCTTAACACCAGTGGAAA A A 1. mRNA: 2. Amino Acid: 3. If the nucleotide at position 23 in the first strand of DNA is changed to "A", what effect would this have on the protein produced?

B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data sheet to find the sequence of the amino acids coded for. TACCATGAGAATTGTGGTCACCTT ΤΤΤΑΤ GGTACTCTTAACACCAGTGGAAA A A 1. mRNA: 2. Amino Acid: 3. If the nucleotide at position 23 in the first strand of DNA is changed to "A", what effect would this have on the protein produced?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA
1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAU
If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand? 5’ACCGATTACGATTACG3’ If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA? 5’ACCGATTACGATTACG3’ In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific. Unique DNA characteristics Similar characteristics Unique RNA characteristics
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'