In your own words Consider the following sequence of DNA:3' - TACATGTTGTAG-5'a) Create a nonsense mutation with the DNA strand and show the effects of themutation on the amino acid sequence. Clearly indicate where the mutation is andstate any consequences of the mutation.b) Provide any two examples of chromosomal mutations. Briefly explain eachexample.MRNA Codon/Amino Acid ChartFirst BaseSecond BaseThird BaseA000L Phenylalanine UCUUUCJ (Phe)UAU1Tyrosine (Tyr)UACJUGUTUGCysteine (Cys)UCCSerine (Ser)UCAUUA,FLeucine (Leu)UUGJUGA - StopAUAA1FstopUAGJUCG-UGG - Tryptophan (Trp)CAU1FHistidine (His)CACCUUTCCU1CGU1CUCFLeucine (Leu)CỦACCProline (Pro)CCACGCFArginine (Arg)CGACAA1 GlutamineACUG-CCG-CAGJ (Glu)CGG-AUUAAU1 AsparagineAAC (Asn)ACUTAGUTUSerine (Ser)AGC-AUC FIsoleucine (le) ACC ThreonineAAUAJАСА(Thr)AAA1FLysine (Lys)AAG-AGA,FArginine (Arg)AGG-AStart MethionineAUG -(Met)ACG-GGAUJ Aspartic AcidGAC(Asp)GUU-GCUGGUUGUCFvaline (Val)GUAGCCFAlanine (Ala)GGCGGlycine (Gly)GCAGAA1 Glutamic Acid GGAAGUG-GCG-GAGJ (Glu)GGG-G

DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the DNA strand and show the effects of the mutation on the amino acid sequence. Clearly indicate where the mutation is and state any consequences of the mutation. b) Provide any two examples of chromosomal mutations. Briefly explain each example. MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G UGU1 Fysteine (Cys) UGCJ UUU Phenylalanine UCU UAUJ Tyrosine (Tyr) UACJ UUCJ (Phe) UCC Serine (Ser) UCA U UUA FLeucine (Leu) UUG UGA - Stop A UAAT FStop UCG UAG. UGG- Tryptophan (Trp) CAU Histidine (His) CAC CUUT CU CGU CGC CUC FLeucine (Leu) CUA Proline (Pro) CCA Arginine (Arg) CGA CAA1 Glutamine A CUG- CCG CAGJ (Glu) CGG- ACU AAUJ Asparagine AGUT FSerine (Ser) AGC- AUUT AUC Fisoleucine (lle) ACC Threonine AACJ (Asn) A AUAJ (Thr) AAA FLysine (Lys) AGA Arginine (Arg) AGG! AÇA A Start Methionine AUG-Met) ACG- AAG- G GCU- GAUJ Aspartic Acid GUUT GGUT GAC (Asp) GGC GUC Valine (Val) GUA GCC Alanine (Ala) GCA G Glycine (Gly) GAAJ Glutamic Acid GGA GUG- GCG- GAGJ (Glu) GGG- G

Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the DNA strand and show the effects of the mutation on the amino acid sequence. Clearly indicate where the mutation is and state any consequences of the mutation. b) Provide any two examples of chromosomal mutations. Briefly explain each example. MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G UGU1 Fysteine (Cys) UGCJ UUU Phenylalanine UCU UAUJ Tyrosine (Tyr) UACJ UUCJ (Phe) UCC Serine (Ser) UCA U UUA FLeucine (Leu) UUG UGA - Stop A UAAT FStop UCG UAG. UGG- Tryptophan (Trp) CAU Histidine (His) CAC CUUT CU CGU CGC CUC FLeucine (Leu) CUA Proline (Pro) CCA Arginine (Arg) CGA CAA1 Glutamine A CUG- CCG CAGJ (Glu) CGG- ACU AAUJ Asparagine AGUT FSerine (Ser) AGC- AUUT AUC Fisoleucine (lle) ACC Threonine AACJ (Asn) A AUAJ (Thr) AAA FLysine (Lys) AGA Arginine (Arg) AGG! AÇA A Start Methionine AUG-Met) ACG- AAG- G GCU- GAUJ Aspartic Acid GUUT GGUT GAC (Asp) GGC GUC Valine (Val) GUA GCC Alanine (Ala) GCA G Glycine (Gly) GAAJ Glutamic Acid GGA GUG- GCG- GAGJ (Glu) GGG- G

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
If the genetic code used 4 bases at a time, how many amino acids could be encoded?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?