Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code for a specific amino acid. The table shows the mRNA codon for each amino acid. Use the genetic code table to answer the questions. 4. The codon for tryptophan is? 5. For leucine, there are __ different options. 6.The codon GAU is for ____ 7. In a stop codon, if the second base is G, the first and third bases are __ and __

Q: AAAC G CA G CCG Phe Gly Arg

A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…

Q: From the previous question regarding the insertion of an A base into the template strand: will this…

A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of…

Q: What would happen if a mutation changed a codon for an amino acid to a stop codon? How about if the…

A: Mutations are changes in DNA sequences. Mutations can occur due to changes in the sequence of bases…

Q: A DNA antisense strand contains the following nucleotide base sequence: CGA  TTT  GGT  TGA From…

A: A single-stranded RNA molecule that is corresponding to one of a gene's DNA strands is referred to…

Q: What is the sequence in the template DNA strand during RNA production that encodes the codon GCU?…

A: Translation is the process of formation of mRNA transcript on DNA template strand.

Q: Explain why the base sequence ATC could not be a codon.

A: A three nucleotide sequence in mRNA molecule that codes for a specific amino acid is known as codon.…

Q: The figure represents tRNA that recognizes and binds a particular amino acid (in this instance,…

A: Your answer is incorrect and the correct answer is 5'-UUC-3' This is because the amino acid…

Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…

A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…

Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…

A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…

A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Explain how a single base change in a gene could lead to premature termination translation of mRNA…

A: Premature termination of translation refers to the termination of protein synthesis before the…

Q: Queștion 1: The protein Collagen alpha-1 has 1671 amino acids. From start to stop codon, how long…

A:

Q: 44

A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: BASIC INFORMATION  TRANSLATION  It is the process in which protein is which formed from the…

Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48

A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.

Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…

A: Ans- Tyrosine was replaced with cysteine.

Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…

A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: Use the table to answer:   A portion of an mRNA attached to a ribosome reads: 5′…

A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…

Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…

A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…

A: During transcription process RNA is formed with the help of complementary base pairing with template…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: Sometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino…

A: A DNA sequence is copied into a messenger RNA in the process of transcription that occurs in the…

Q: After the ribosome slides along the mRNA, the dipeptide will be attached to the tRNA in the ________…

A: The RNA molecule transition ribonucleic acid (tRNA) assists in the translation of a messenger RNA…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…

Q: Use the chart here to answer the following question. Second Base in Codon U A G UUU) UCU UAU] UACTyr…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide…

A: Point mutation It refers to the mutation in which the single-nucleotide of the sequence of DNA…

Q: What is the sequence in the DNA that specifies the codon GCU? Answer with 5’ and 3’ ends labeled.

A: Codons  Codons are the triplet form of mRNA which code for specific amino acid. In living organisms…

Q: Use the codon table shown above to help answer this question. Changing a UUG codon in mRNA to a UAG…

A: Proteins are made up of amino acids in a specific sequence and if mutation occur then the sequence…

Q: Create protein sequence with 10 elements. (Start with a codon and ends with a stop codon)

A: Protein sequencing is the cycle of deciding the amino acid arrangement of all or part of a protein…

Q: Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser

A: Codons are the triplet base of the nucleotide sequence, which encodes the amino acids during…

Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…

A: Codon are the triple of a base pair.

Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…

A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…

Q: A protein had the amino acids leu-gly at codons 10 and 11. A deletion of the 5’ base of the leu…

A: Codons are trinucleotide sequences and it codes for specific amino acids. The human genome contains…

Q: Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U…

A: Question - Refer to the genetic code table and the mRNA sequence below to complete this question: U…

Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…

A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…

Q: After RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?

A: According to the central dogma, the most common arrangement of information in our cells is: Making…