Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below. For each question: A) Determine the resulting polypeptide from the mutated DNA sequence. Don't worry about finding a start codon - just express the DNA as a polypeptide. If there is a stop codon - Write the sequence in the provided blank using the three letter abbreviation for the codon - e.g. Ile Trp Val (with spaces) or lleTrpVal (without spaces). B) Classify the type of mutation by filling in the provided blanks. Your choices are: nonsense, missense, silent, insertion or deletion • Sense DNA: 5'-ATCTCCTGGTAA-3' 1. Polypeptide sequence 2. Mutation type • Sense DNA: 5'-ATGTCCGTGGTAA-3' 1. Polypeptide sequence • 2. Mutation type

Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below. For each question: A) Determine the resulting polypeptide from the mutated DNA sequence. Don't worry about finding a start codon - just express the DNA as a polypeptide. If there is a stop codon - Write the sequence in the provided blank using the three letter abbreviation for the codon - e.g. Ile Trp Val (with spaces) or lleTrpVal (without spaces). B) Classify the type of mutation by filling in the provided blanks. Your choices are: nonsense, missense, silent, insertion or deletion • Sense DNA: 5'-ATCTCCTGGTAA-3' 1. Polypeptide sequence 2. Mutation type • Sense DNA: 5'-ATGTCCGTGGTAA-3' 1. Polypeptide sequence • 2. Mutation type

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

If the genetic code used 4 bases at a time, how many amino acids could be encoded?
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codon
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Using a table that shows which codon represents which amino acid determine the following: A) The possible codons that encode Serine: B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:
The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the above
Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code c. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon g. Nonsense codon h. Universal code i. Nonuniversal codons 6. How is the reading frame of a nucleotide sequence set?
explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codon
From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?