Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO

Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…
A hereditary disease is inherited as an autosomal recessive trait. The wild-type allele of the disease gene produces a mature mRNA that is 1250 nucleotides (nt) long. Molecular analysis shows that the mature mRNA consists of four exons that measure 400 nt (exon 1), 320 nt (exon 2), 230 nt (exon 3), and 300 nt (exon 4). A mother and father with two healthy children and two children with the disease have northern blot analysis performed. The results of the northern blot for each family member are shown below. a) Identify the genotype of each family member, using the size of mRNAs to indicate each allele. (For example, a person who is homozygous wild type is 1250/1250). b) Based on your analysis, what is the most likely molecular abnormality causing the disease allele?
1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
With this gene provided: MuPKS c.1949 C>T (p.R644W) Please provide the following; 1. Name of the gene 2. Location of the nucleotide change 3. Nucleotides that are changed 4. Type of mutation 5. Amino acid change 6. Location of the amino acid change
You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA -- GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). Using the wild type DNA sequence above as a guide : Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: T --> G transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14 Mutant 4: transition at nucleotide 7 Mutant 5: An insertion of GG after nucleotide 40 Mutant 6: transition at nucleotide 15 Mutant 7: a deletion of nucleotide 25
You graduate and land a job in a medical genetics laboratory. A particular family has been identified in which a heritable genetic disease has arisen. Through genetic mapping, you identify a mutation in afflicted individuals that is likely causing this condition. In unafflicted members of this family, a region in the coding sequence of the gene in question has the sequence: 5’-CACATGATGATGATGATGATGCGT-3’ However in afflicted individuals, the gene has the sequence: 5’-CACATGATGATGATGATGATGATGATGCGT-3’. (A) Please propose a detailed mechanism for how this genetic change could have arisen, and illustrate this with a diagram below or on the back of this page. (B) Would mutations affecting this region of the gene be likely to cause a frame-shift in the protein coding sequence? Why or why not? In a related genetic disease, the wild-type or normal allele has the sequence: 5’-CAGCACACACACACACACACAGGTG-3’ (C) Would mutants arising via the mechanism you just described be likely to result…
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
Gene mutations can be classified in two major ways:(1) hereditary or germline mutations that are inherited from a parent and are present throughout a person’s life in virtually every cell in the body.(2) acquired or somatic mutations that occur at some time during a person’s life and are present only in certain cells, not in every cell in the body.If there is no family history of a particular disease but a child has the disease then it may have arisen due to a(n) ________ mutation early during development. A) acquired B) inherited C) silent D) transition
Give a schematic diagram of how we can Treatment Down's syndrome by using gene therapy? Please answer at your own words,please..
a. When gene probes, fi ngerprinting, and sequencing make it possible for you to know about genetic diseases in you or one of your children, would you wish to use this technology to fi nd out? b. What if it were used as a screen for employment or insurance? c. Most of us would agree to growth hormone therapy for a child with dwarfi sm, but how do we deal with parents who want to give growth hormones to their 8-year-old son so that he will be “better at sports”?