Consider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this will not cause a missense mutation. Please answer the following questions. 1. Explain why the outcome in this scenario is NOT a missense mutation. 2. Describe the purpose of a gene's promoter.

Consider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this will not cause a missense mutation. Please answer the following questions. 1. Explain why the outcome in this scenario is NOT a missense mutation. 2. Describe the purpose of a gene's promoter.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 11QP: Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA

See similar textbooks

Related questions

Q: Describe the advantages and disadvantages of the following mechanisms of regulation: Transcriptional…

A: Mechanisms of regulation are very important in regulating the transcription and translation…

Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…

A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…

Q: Complete Table 1, indicating how much (lots, little, none) of the above gene product would be made…

Q: Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match…

A: All eukaryotes possess three different RNA polymerases namely, RNA polymerase I, RNA polymerase II…

Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…

A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…

Q: 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries…

A: 5) To calculate molecular weight (KiloDalton [kD]) and the calculated pI of the protein, submit the…

Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: In the treatment of cancer, the basis for many types of chemotherapyand radiation therapy is that…

A: The tumor is irregular growth of tissue. It is the first stage of tumor development. The…

Q: Which of the following statements uses the term homologous correctly?A. The two X chromosomes in…

A: Homologous genes refer to the genes that are inherited in two species by a common ancestor. These…

Q: Please use the following terms and describe how each works to control protein expression. -…

A: The process in which the DNA is trans formed into an mRNA is known as the process of transcription.…

Q: A researchist has found that 1 human promoter is responsible for producing 2various proteins…

A: The information carried by our genome in the form of DNA goes through a number of processes before…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5'…

A: According to the question, we have to write down the messenger RNA sequence ad the polypeptide chain…

Q: Mention four human genetic diseases that result from single gene mutation, please answer this…

A: Because of their uncomplicated inheritance patterns (recessive or dominant) and relatively simple…

Q: In relation to central dogma of molecular biology answer the following questions: The following…

A: Central dogma of molecular biology depicts how information in the DNA is transcribed into RNA and…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter…

A: Binding of RNA polymerase II and transcription factors is necessary for transcription.

Q: Can someone give me a few inherited disorders that are NOT caused by mutations? and if possible,…

A: Tay Sachs disease- Children's with the tay Sachs disease appears healthy at birth but becomes…

Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…

A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…

Q: B-thalassemia is a hereditary blood disorder that leads to the formation of an abnormal hemoglobin…

A: Answer is option A.

Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…

A: The protein translation is the process of the formation of proteins from the mRNA formed from the…

Q: e. More than 82% QUESTION 11 You have sequenced mRNAs from an esophogeal cancer tumor and mRNAS from…

A: Genes that are unexpressed in cancer cells are :-

Q: define the term name as Missense mutations

A: sometimes a wrong nucleotide will be incorporated in the DNA. that can result in a type of mutation…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: Discuss the mechanisms by which transcription factors influence the reprogramming of somatic cells…

A: Somatic cells are similar to human beings in that they develop to fulfill a specific purpose in…

Q: Use the information uploaded in the picture to help with this question. Would you conclude that…

A: through Ames test we can check whether the compound is mutagenic or not.

Q: 70

A: The conversion of information saved in the DNA to proteins is required. The central dogma describes…

Q: Assume that a mutation occurs in the gene that encodes RNA pol II. What would be the effect of the…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Explain how the mRNA vaccine work and relate to protein synthesis (Moderna and Pfizer vaccines are…

A: mRNA (messenger RNA) is a single-stranded molecule found in all of our cells. It transports the…

Q: Write a short description about post transcriptional modifications? proper explanation and diagram

A: Post-transcriptional modifications: The eukaryotic pre-mRNA undergoes extensive processing after…

Q: Name four types of point mutations that can occur in a gene coding for a protein. Discuss the…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Some mutations affect changes in protein structure and function that can result in disease whereas…

A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering the first…

Q: Complete Table 1, indicating how much (lots, little, none) of the above gene product would be made…

A: Transcription It is defined as the process of transcribing the segment of the DNA to the RNA, which…

Q: A mutation in which of the following would still allow RNA polymerase to bind to promoters but would…

A: To start transcribing a gene, RNA polymerase binds to the promoter region of the gene's DNA. It has…

Q: Answer these questions concerning promoters. a) What role do promoters play in transcription? b)…

A: A region in DNA molecule that initiates transcription of a particular gene is referred to as a…

Q: In order to manufacture insulin for patients with diabetes, scientists create recombinant DNA by…

A: Recombinant DNA technology is the method which scientists used to insert human gene into bacterial…

Q: This is a list of molecular changes that could happen during DNA replication, transcription, mRNA…

A: The mutation alters allele frequencies by constantly introducing new alleles, which can be…

Q: DNA sequencing has provided data to indicate that cancer cells may contain tens of thousands of…

A: Cancer cells are defined as the cells that will divide relentlessly and continuously; thus, forming…

Q: Explain five ways that eukaryotic gene regulation is more complex than bacterial gene regulation?

A: Prokaryotes and eukaryotes differ in number of ways. We all are aware of this fact that eukaryotes…

Q: A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase…

A: Mutation refers to sudden change in the genetic material and is heritable. It may be on chromosomal…

Q: Which is the mRNA molecule that would be transcribed from this DNA template:…

A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…

Q: Match the term with its corresponding definition. a. Insertion e. Nonsense Mutation b.…

A: Mutation is a process wherein a DNA gene is damaged or changed in such a way that the genetic…

Q: For the given mutation below,please write down the reverse mutation and any intragenic suppressor…

A: Reverse mutation It is the mutation which denotes the mutational process that restores the wild type…

Q: Consider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…

A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…

Q: In both prokaryotic and eukaryotic cells, gene regulation occurs primarily at the transcriptional…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: Please choose the correct answer. Which of the following statements is NOT true about reverse…

A: Which of the following statements is NOT true about reverse transcription The correct answer would…

Q: Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match…

A: RNA polymerase I is found in higher eukaryotes. It synthesizes only ribosomal RNA (rRNA). It…

Q: Indicate whether the following sentences is either True or False and CORRECT the wrong sentences (…

A: Since you have posted multiple questions we solve the first question for you. To get the remaining…

Q: ology answer the following questions: The length of a particular gene in human DNA, measured from…

A: DNA is the genetic material responsible for storage and transmission of genetic material. It…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Consider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this will not cause a missense mutation. Explain why the outcome in this scenario is NOT a missense mutation. Describe the purpose of a gene's promoter.
DNA methylation status is associated with transcriptional activity. First, describe the specific mechanism by which DNA methylation can control gene activation. Next, hypothesize what would happen to transcription in a cell that expressed an nonfunctional maintenance methyltransferase. Please give me long detailed answer.
A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers provided
A mutation within the promoter region can alter transcription of a gene. Describe how this can happen.
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Use the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?
Use the information uploaded in the picture to help with this question. Would you conclude that IP-1383 induces mutations or not? Briefly (one or two sentences) explain how or why you came to your conclusion.
Answer these questions concerning promoters. a) What role do promoters play in transcription? b) What is the common structure of bacterial promoter with respect to consensus sequences? c) Eukaryotic promoters are more variable than bacterial promoters. Why? d) What is the meaning of the term alternative promoter? How does the use of alternative promoters affect transcription?
The mutation associated with pancreatic cancer in the family was located in an exon of the palladin gene. In general, would you expect to find more cancer-causing mutations in exons or in introns? Explain your answer.
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
In the treatment of cancer, the basis for many types of chemotherapyand radiation therapy is that mutagens are more effective at killingdividing cells than nondividing cells. Explain why. What are possibleharmful side effects of chemotherapy and radiation therapy?
Random mutation in the DNA sequence of a coding gene can lead to different genetic outcomes. Provide two examples of how a mutation can lead to changes in a gene’s function and how this mutation could modify the gene.