II||||| || III fl | || I I| | II||||| | || on Completion Status: 100 11 120 130 14G150 36 16 170 19 50 bp ladder ladder 4. 3. So.00/2.00 S0.25 S0.45 Plasmid BS1030 S 1.50 2.0 kb So.55 S1.10 Click Save and Submit to save and submit. Click Save All Answers to save all answers. 3. 6.
Q: The principle of the alkaline method for plasmid DNA isolation is: O A. An acidic solution…
A: Plasmid DNA isolation by alkaline lysis method This method is the most commonly used method to…
Q: You have 2 solutions of DNA. Solution 1 contains single stranded viral DNA while Solution 2 has…
A: DNA is deoxyribonucleic acid. It comprises nucleotide bases, deoxyribose sugar, and the phosphate…
Q: functions. The structure that provides high processivity (processivity factor) is represented by the…
A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…
Q: You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you…
A: DNA stands for De-oxyribonucleic Acid. DNA is polymer of nucleotides. Nucleotides are molecules…
Q: Plasmid map of pUCT8/T9 Eco01091 2674 Pfol 46 Aatil 2617 Sspl 2501 Pdml 2294. Bogl 2216 2486 146/
A: Restriction enzymes are the enzymes which cut DNA at a specific location called as restriction site.…
Q: Primer design for SLIC cloning and the protocol
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: 18. An instructor had her students perform this laboratory beginning with setting up their own…
A: Agarose gel electrophoresis is the technique for the separation of DNA fragments on the basis of…
Q: Question 7 Referring to the plasmid below, if a recombinant plasmid were obtained by inserting DNA…
A: The plasmid is the extrachromosomal DNA present in prokaryotic organisms. They have the ability to…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: A genome is the genetic material of an organism. It consists of deoxyribonucleic acid (DNA). The…
Q: If 20% of a culture of human cells have a DNA content somewhere between 1 and 2xs (S-phase = 8…
A: Generation time is the duration of time in which a population of cells doubles itself.
Q: Choose the one answer that fits best. Read carefully. Which of the following statements about the…
A: Option C is not correct-The plasmid used for transformation is called E.coli
Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…
A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…
Q: 4. Animation 12.4: This table shows results from a genetic test conducted on DNA samples from two…
A: Restriction enzymes are the enzymes capable of cutting double-helical segments that contain a…
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…
A: DNA is a double helical molecule.
Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Transcription is the process of making RNA copy of gene sequence. This copy is called mRNA.…
Q: 2. A plasmid was digested with the enzymes BamHI, ECORI, and HindIII. A single digest was performed…
A: A restriction map describes the location of all the restriction sites on a DNA (deoxyribonucleic…
Q: Need question 6 answered
A: Agarose gel electrophoresis is the method in molecular biology, which is used to separate the DNA or…
Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Nucleic acid is a macromolecule that is exhibited inside the nucleus . It consists of DNA and RNA…
Q: 6. You perform a restriction digest that should yield 1,400 bp, 1,080 bp, 1,000 bp, and 400 bp…
A: There are different biomolecules, including DNA, RNA, proteins, etc., are present, and these…
Q: PGLO plasmid DNA solution with the UV lamp. Note yo observations. Using a micropipetto withdraw 10…
A: pGLO plasmid has GFP as reporter gene. This plasmid is used as vector to carry desired gene of…
Q: 2. Your Genetics professor gives you and your classmate's information on a restriction digest. The…
A: The advantages of biotechnology for our society can be in drug manufacturing at a low cost using…
Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…
A: Restriction enzymes are the DNA digesting enzymes.
Q: 8. You have completed an in-vitro mutagenesis experiment to create an A → I mutation in the first…
A: A gene is a sequence of DNAs. DNA is composed of nucleotide sequences. During the process of…
Q: 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: Question 7 Referring to the plasmid below, if a recombinant plasmid were obtained by inserting DNA…
A: A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's…
Q: What happens if you forget to add Sybrsafe to a gel that will be used for DNA gel electrophoresis…
A: Gel electrophoresis is a gel technique that separates DNA and proteins based on their mass, by means…
Q: 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the pMBBS…
A: As per the guidelines, we are supposed to answer only three subparts. Kindly repost the question…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: 8. What polypeptide sequence does the inserted gene code for? (Review protein synthesis and write…
A: The given question is based on the activity of the t rna that produces the protien by recognising…
Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…
A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…
Q: In Figure 5-18c, why is the crossover shown occurring inthe orange segments of DNA?
A: Crossing over is a process in which DNA or genes are exchanged between two homologous chromosomes…
Q: Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING…
A: The restriction enzymes are type of nuclease enzymes. These enzymes have the capability to cleave…
Q: What is the purpose of using the Chelex beads while extracting the DNA at high temperature from your…
A: Answer is option A.
Q: constructing a map of the plasmid, pDiddy. What is the smallest fragment size that the…
A: Double digestion Restriction enzymes are eye enzymes that induce cuts(cleavage) at their specific…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: the genome is never a static entity, it constantly undergoes changes in its sequence either due to…
Q: A sample of chromatin was partially digested by the enzyme Staphylococcal nuclease. The DNA…
A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…
Q: Figure 8.12 In the accompanying figure, the green rectangular shape represents_ O a. DNA…
A: All genetic information are stored in DNA, which is present in nucleus in case of eukaryotic cell…
Q: The DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells.…
A: DNA synthesis is a semiconservative process in both eukaryotes and prokaryotes. This means that each…
Q: You have PGFPuv at 75ng / uL You need 1.15 ng total DNA in a final volume of 30 . Calculate how much…
A: pGFPuv encodes a green fluorescent protein (GFP) variant from Aequorea victoria that has been…
Q: (kbp) (bp) 4. To the right is an image of an agarose gel. Lanes 1 and 4 are DNA markers (DNA sizes…
A: Agarose gel electrophoresis is the process by which DNA fragments are run on the basis of their…
Q: DNA before and after mutation. Which of on. Which of the following are CORRECT about the types of…
A: Mutation is the change in the nucleotide of the DNA sequence which ultimately affects the Amino acid…
Q: Ap Normal No Spacing Head 目三。、田 Paragraph Styles 1. You heve a circuler plasmid (pUC57), which…
A: We are allowed to do one or upto three subpart of a question. Please repost the undone question…
Q: Below is shown a plasmid map from a recombinant DNA experiment you have performed. You inserted your…
A: Electrophoresis is a technique used to separate macromolecules like DNA, RNA, and proteins based on…
Q: 1. A plasmid was digested with two restriction enzymes, individually and in a double digest. The…
A: The restriction enzymes cleave DNA (deoxyribonucleic acid) molecules at specific sequences called…
Q: 25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a…
A: Restriction enzymes are molecular scissors that are used in recombinant DNA technology to cut DNA at…
Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: A restriction endonuclease, also known as a restriction enzyme, is a bacterial enzyme that…
Q: 1. You have a circular plasmid (PUC57), which consists of 2710 bp. What would the number and length…
A: If we cut a circular plasmid at 2 sites then 2 fragments would be generated. Similarly, for 3 cut…
Q: FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved.…
A: Restriction enzymes are the most important tool in genetic engineering. These enzymes have the…
Q: Why is the scale of this map in minutes?
A: The genetic map of a chromosome tells the position of different genes.
Q: 1.1kbp 1.5 kbp Hindll Hindll 0.15 kbp amp 0.25 kbp If you were to digest this plasmid with HindllI,…
A: Plasmids are a small, extrachromosomal segment of DNA(deoxyribonucleic acid) and are mostly found in…
which sample shows the plasmid is fully digested
Step by step
Solved in 4 steps
- #1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
- Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'Margaret has been given a plasmid containing her favorite gene, afg (Margaret’s favorite gene). The only thing sheknows is that afg was cloned into the vector using a single restriction enzyme, BstBI. Margaret orders theBstBI enzyme from NEB, so she can cut the plasmid and confirm the presence of the insert. On theNanodrop, she measures the concentration of her plasmid to be 401 ng/μL. Describe how she would setup and perform this reaction if she wanted to digest 2.0 μg of the plasmid.#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- Hi, this is my Recombinant "Paper" Plasmid activity question, I did other parts, but this question I really have no clue what it is. I attached a photo of the letters on the inserted gene code, please help me figure out what it means, Thanks a lot. It is the shaded region#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:describe each step carefully and use your own words. Steps will be like following; I) Primer design for SLIC cloning and the protocol II) Transformation and sequence validation of the clones III) Culture of HEK293T IV) Transduction of HEK293T cells with plasmid V) Western Blotting VI) Immunfluorescence for Confocal Microscopy
- I have a 1.270 ug/uL dna stock, how would you dilute this to 50ng/nL in a single dilution step? show the exact process including the volume of water. Indicate if you would use p20,p200,p1000 for each reagant added. you can choose a total volume but cannot be less than 3 uL or exceed 1000uL. Thank you!!Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyWhen you are loading the DNA ladder into your gel the volume needed is 5uL. The appropriate micropipette for this volume is a: 1)p2 2)p200 3)p1000 4)p20