You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you transcribe mRNA from the DNA and purify it. You then separate the two strands of the DNA and analyze the base composition of each strand and of the mRNA transcripts. You obtain the following results: A G C T UDNA strand #1 19.1 26.0 31.0 23.9 0DNA strand #1 24.2 30.8 25.7 19.3 0mRNA 19.0 25.9 30.8 0 24.3Which strand of the DNA is the “sense” strand that serves as the template for mRNA synthesis?

You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you transcribe mRNA from the DNA and purify it. You then separate the two strands of the DNA and analyze the base composition of each strand and of the mRNA transcripts. You obtain the following results: A G C T UDNA strand #1 19.1 26.0 31.0 23.9 0DNA strand #1 24.2 30.8 25.7 19.3 0mRNA 19.0 25.9 30.8 0 24.3Which strand of the DNA is the “sense” strand that serves as the template for mRNA synthesis?

Name: You are provided with a sample of aardvark DNA. As part of your invest
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you transcribe mRNA from the DNA and purify it. You then separate the two strands of the DNA and analyze the base composition of each strand and of the mRNA tr

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

You obtained a sample of double-stranded DNA and transcribe mRNA from this DNA. You then analyse the base composition of each of the two DNA strands and the one mRNA strand, and get the following results. The numbers indicate percentage of each base in the strand: A G C T U strand 1 40.1 28.9 9.9 0.0 21.1 strand 2 21.5 9.5 29.9 39.1 0.0 strand 3 40.0 29.0 9.7 21.3 0.0 i) Which of these strands must be the mRNA? Explain. ii) Which one is the template strand for the mRNA? Explain. iii) What would be the likely sequence for the mRNA codons and the tRNA anticodons if the template DNA had the following sequence: 3' T A C A T A C G G T T A C G T 5'.
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
Which of the following regions of a genome would be most likely to be a SINGLE CRE? A. A section of DNA that is 10 base pairs long B. A section of DNA that is 50 base pairs long C. A section of DNA that is 200 base pairs long D. A section of DNA that is 1500 base pairs long
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 311. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion…
A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.
Four nucleic-acid samples are analyzed to determine the percentages of nucleotides they contain. Survey the data in the table below to determine which samples are DNA and which are RNA, and specify whether each sample is double-stranded or single-stranded. Justify each answer (DNA and RNA can be both single and double-stranded). A G T U C Sample 1 23% 27% 23% 0 27% Sample 2 35% 35% 0 15% 15% Sample 3 17% 33% 0 17% 33% Sample 4 30% 30% 20% 0 20% Sample A is Sample B is Sample C is Sample D is
You are presented with the following DNA molecule: 5’ A T G C G A T T A T A A 3’ 3’ T A C G C T A A T A T T 5’ A. Write the template DNA strand B. Transcribe the template DNA strand into mRNA C. Translate the mRNA into an amino acid sequence
Write the sequence of a strand of DNA replicated using each of the following base sequences as a template: a. T C G A G A A T C T C G A T T b. C C G T A T A G C C G G T A C c. A T C G G A T C G C T A C T G
DNA from actively dividing bacteria was isolated and examined to find two groups of DNA. One group DNA included very large molecules (thousands or even millions of nucleotides long), and the other included short stretches of DNA (several hundred to a few thousand nucleotides in length). What was the researcher actually seeing in these two groups? Group of answer choices mRNA molecules and siRNA molecules Okazaki fragments and RNA primers leading strands and Okazaki fragments leading strands and RNA primers
Write the base sequence in a complementary DNA segment if each original segment has the following base sequence: a.) 5'T T T T T T 3' b.) 5'C C C C C C C C C 3' c.) 5'A T G G C A 3' d.) 5'A T A T G C G C T A A A 3'
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 2. If the above DNA strand is the template (antisense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 11th base was replaced by Cytosine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 2nd base was deleted. Is there an effect in the structure and function of the synthesized protein? Specify type of mutation in relation to protein function. What type of mutation is demonstrated here?c. Thymine is inserted between the 21st and 22nd gene. Is…