Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has no impact on the length of the mRNA transcribed from the gene.
Q: As a genetic counselor, you are asked to assess the risk for a couple with a family history of…
A: Familial adenomatous polyposis is an inherited disease that is autosomal dominant and results in…
Q: A geneticist examines an ear of corn in which most kernels are yellow, but he finds a few kernels…
A: The anthocyanin pigment produced by corn is responsible for its peculiar purple colour. This happens…
Q: Are the rates of recombination in males and females the same? If not, what might produce the…
A: Recombination refers to a phenomenon in which the genes get mixed up and result in a different…
Q: Identify the following chromosomal mutations.
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'
A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…
Q: When a female melanotic fly is crossed with a normal male, the progeny are produced: 123 normal…
A: In the question, it is given that the in the F1 generation, the melanotic progeny is only expressed…
Q: Why are diseases due to microsatellite amplification, even though they have a monogenic pattern of…
A: The classical inheritance is the type of inheritance pattern in which mendelian laws are followed…
Q: For genes that are close together, the frequencies ofcotransformation or cotransduction are…
A: Transduction is the process by which foreign DNA is introduced into a cell by a virus or viral…
Q: In McCune-Albright syndrome, fibrous connective tissue replaces bone, tan patches (café-au-lait…
A: A mutation is considered a change in the DNA sequence, which can be either an addition or deletion…
Q: Prader-Willi syndrome is caused by a mutation in anautosomal maternally imprinted gene. Label the…
A: A mutation is an alternation in the DNA sequence, and mutation can result from the addition,…
Q: What impact does the environment have on traits?
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: A 50-year-old man undergoes genetic testing for hemochromatosis, an autosomal recessive disease…
A: Mendelian inheritance refers to inheritance of disease from parents to offspring but this term…
Q: A family is tested for spinal muscular atrophy, an autosomal recessive disease, using RFLP. The…
A: Given: Spinal muscular atrophy - an autosomal recessive disease (aa) Carrier for spinal muscular…
Q: Sandhoff disease is due to a mutation in a gene that encodes a proteincalled hexosaminidase B. This…
A: Step 1 Genetic disorders are defects that are caused by a genetic mechanism. The genetic character…
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…
A: Cystic fibrosis is a disease of the mucus secretion in which thick viscid mucus is secreted which…
Q: You have a 5'(A/T)–3' SNV potential. Draw out to explain why using the sense strand and template…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Define deletion-insertion polymorphisms (DIPs)
A: Insertion is a mutation in which one or more nucleotide base pairs are added into a DNA sequence.…
Q: Below are some actual alleles of the gene for phenylalanine hydroxylase enzyme. What is shown for…
A: Alleles are the alternative form of a gene. The alleles codes for the different versions of a…
Q: Two related forms of muscular dystrophy—Duchenne muscular dystrophy (DMD) and Becker muscular…
A: Muscular dystrophies cause muscle weakness and atrophy in the skeletal muscles exclusively in males.…
Q: Discuss mobility in the human genome
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: Suppose, you want to detect the CAG repeat expansion within a particular gene (30 repeats in normal…
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: What are the different components of expression vector? Explain in detail. Also give two…
A: An expression vector is a plasmid or virus which is used for the purpose of gene expression in…
Q: Explain how a loss-of-function allele in a gene encoding a cohesin protein could be dominant to…
A: Cornelia de Lange syndrome (CdLS) is a rare human disease caused by a dominant loss-of-function…
Q: You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG…
A: DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC…
Q: a. For the E.coli haploid genotype below, determine the phenotype for the following proteins. Assume…
A: Lac operon Lac operon or the lactose operon is a gene expression system in E Coli. and many similar…
Q: Duchenne muscular dystrophy (DMD) is an X-linked recessive genetic disease caused by mutations in…
A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…
Q: When the organization of adjacent genes with highly similar sequences is in an inverted orientation,…
A: The physical unit of heredity is known as the gene. The term "inversion" refers to a mutation that…
Q: given the photos below, what general type of chromosomal mutation did colchicine induce ? 1st photo-…
A: Colchicine induce polyploidy. Colchicine prevent the microtubule formation during cell division…
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…
A: Cystic Fibrosis - An hereditary disease that affects the lungs and digestive system and can be…
Q: determine the approximate number of amino acids that would be missing in the telomerase protein of a…
A: Telomeres are the repeating nucleotide sequences found at the ends of chromosomes. Telomeres…
Q: White eyes in Drosophila melanogaster result from an X-linked recessive mutation. Occasionally,…
A: The transposable elements are the DNA sequence that may change its position or location within the…
Q: The HbβS(sickle-cell) allele of the human β-globingene changes the sixth amino acid in the…
A: Sickle cell anemia is a blood disorder in which an improper folding of hemoglobin occurs. In this…
Q: How many number of genes a Mouse (Mus musculus) has ?
A: The study of genomes' design, functioning, development, sequencing, and modification is the core of…
Q: The DNA of every individual in the pedigree shown below has been sequenced at the causative locus.…
A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…
Q: >chromosomal…
A: Codons are trinucleotide sequence that codes for specific amino acids and there are totals of 64…
Q: Tay–Sachs disease is caused by loss-of-function mutations ina gene on chromosome 15 that encodes a…
A: Tay–Sachs disease can be defined as a hereditary condition that causes nerve cells present in the…
Q: Six pure-breeding strains for eye color mutations in Drosophila are developed and crossed. Red is…
A: The "mutation" alters allele frequencies by constantly introducing new alleles, which can be…
Q: When expressing X-linked recessive gene notation, how should the notation be written. Should I use…
A: X-linked recessive inheritance is a type of inheritance in which a mutation in a gene on the X…
Q: Describe the exact DNA mutation that has occured, to create the mutant dystrophin allele.
A: Complex of dystrophin and glycoprotein (DGC). Dystrophin is a rod-shaped protein that binds the…
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…
A: Answer: #2
Q: Comparing the colchicine-treated cell and the untreated cell, what general type of chromosomal…
A: Colchicine is a microtubule destabilizing drug and is used for the treatment of rheumatoid…
Q: State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change…
A: As per the guidelines we are supposed to answer only the first question In case of multiple question…
Q: To cause cancer, proto-genes require blank allele(s) to be mutated and therefore are considered…
A: ANSWER;- To cause cancer, proto-genes require a single allele(s) to be mutated and therefore are…
Q: 6.8 Define a map unit and explain why map units best reflect the real distances between two genes…
A: Genetic map are used to represent the linkage of genes in a chromosome. Genetic maps are mainly used…
Q: Are changes that cause high FST found equally across the genome? What areas of the genome would be…
A: The fixation index is a measure of the population difference due to the genetic structure. It is the…
Step by step
Solved in 2 steps
- A 30 - year - old woman was undergoing therapy for b-thalassemia,a recessive trait caused by absence of or reduced synthesis ofthe hemoglobin b chain, a subunit of the oxygen-carrying moleculein red blood cells. In this condition, red blood cells are rapidlydestroyed, freeing a large amount of iron, which is deposited in tissuesand organs. The blood transfusions the patient had received every twoor three weeks since the age of 7 to stave off anemia were furtheraggravating iron buildup. Her major organs were showing damage, andshe was in danger of death from cardiac disease. Her physician suggestedthat she consider undergoing a hematopoietic (bone marrow)stem cell transplant (HSCT). Since these stem cells give rise to redblood cells, such a transplant could potentially restore her health. Whilethis might seem like an easy decision, it is not. Advanced cases havea high risk (almost 30 percent) for transplantation-related death. At thispoint, the woman is faced with a difficult and…A 30 - year - old woman was undergoing therapy for b-thalassemia,a recessive trait caused by absence of or reduced synthesis ofthe hemoglobin b chain, a subunit of the oxygen-carrying moleculein red blood cells. In this condition, red blood cells are rapidlydestroyed, freeing a large amount of iron, which is deposited in tissuesand organs. The blood transfusions the patient had received every twoor three weeks since the age of 7 to stave off anemia were furtheraggravating iron buildup. Her major organs were showing damage, andshe was in danger of death from cardiac disease. Her physician suggestedthat she consider undergoing a hematopoietic (bone marrow)stem cell transplant (HSCT). Since these stem cells give rise to redblood cells, such a transplant could potentially restore her health. Whilethis might seem like an easy decision, it is not. Advanced cases havea high risk (almost 30 percent) for transplantation-related death. At thispoint, the woman is faced with a difficult and…Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?b. Can you think of other methods to determinewhether an allele represents the null state of a particular gene?
- Primer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgccccccThe phenotype of individuals heterozygous for ________ alleles comprises both homozygous phenotypes. a. epistatic b. codominant c. pleiotropic d. hybridFor the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…
- You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ 1. For the second, third, fourth, and fifth codons, write all possible anticodon sequences (left-to-right, 5’-3’), including anticodons with wobble and inosine. 2. Write the amino acid sequence of the wild-type allele (three letter or single-letter amino acid abbreviation ok). 3. For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). D. Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: TG transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14…AaBbCc x AaBbcc How would you characterize this kind of relationship between the genes: A-B- (gray); A-bb (yellow); aaB- (black); aabb (cream) The CC and Cc genotypes allow color according to the expression of the A and B alleles. However, the cc genotype results in albino rats regardless of the A and B alleles present2. Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?
- 1. There are two different variations at STR locus THO1. Where did these variations come from? b) The STR locus D21S11 only has one variation. Why?5. In the fruit fly Drosophila melanogaster, very dark(ebony) body color is determined by the e allele. Thee+ allele produces the normal wild-type, honeycolored body. In heterozygotes for the two alleles (butnot in e+e+ homozygotes), a dark marking called thetrident can be seen on the thorax, but otherwise thebody is honey-colored. The e+ snd e alleles are thusconsidered to be incompletely dominant.a. When female e+e+ flies are crossed to male e+eflies, what is the probability that progeny will havethe dark trident marking?b. Animals with the trident marking mate amongthemselves. Of 300 progeny, how many would beexpected to have a trident, how many ebony bodies, and how many honey-colored bodies?The XG locus on the human X chromosome has twoalleles, XG+ and XG. The XG+ allele causes the presence of the Xg surface antigen on red blood cells,while the recessive XG allele does not allow antigento appear. The XG locus is 10 m.u. from the STSlocus. The STS+ allele produces normal activity ofthe enzyme steroid sulfatase, while the recessive STSallele results in the lack of steroid sulfatase activityand the disease ichthyosis (scaly skin). A man withichthyosis and no Xg antigen has a normal daughterwith Xg antigen. This daughter is expecting a child.a. If the child is a son, what is the probability he willlack Xg antigen and have ichthyosis?b. What is the probability that a son would have boththe antigen and ichthyosis?c. If the child is a son with ichthyosis, what is theprobability he will have Xg antigen?