C++ : Write a function that has three C++ strings as parameters. It searches the first parameter to find the second parameter (as a substring) and replaces it with the third parameter. It returns the changed first parameter if the substring can be found; otherwise, it returns the original first parameter. Test your function in a program.

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

5. use c code to Write a stringSearch function that gets two strings one called needle and the other called haystack. It then searches in the Haystack for the needle. If it finds it, it returns the index of where the needle starts in the haystack. If the needle cannot be found, it should return -1 Prototype: int stringSearch(char needle[], char haystack) Example1: Haystack: “This is just an example” Needle: “just” Result: 8 Example2: Haystack: “This is just an example” Needle: “This” Result: 0 Example3: Haystack: “This is just an example” Needle: “this” Result: -1 Hint: all the answer need to include an output and use c code to answer

Programming technique exercise Question 1). Write a complete C++ program that helps the teacher to calculate the result of students in the test of Programming Technique. The program should perform the following tasks: • Write a function named getinput. This is a non-returning function. It takes the score of question 1, score of question 2, and score of question 3 as input parameters. the function should ask the user to enter the score (per 100) for each question. It sends all the values entered by the user in (c) back to the calling module through the use of reference parameters. • Write a function named dispTier. This is a non-returning function. It takes the total marks as an input parameter. The function should display the tier based on the conditions. Tier 3 = below 40%, tier 2 = below75%, tier 1=75% and above • Write a function named calcAverage. I It takes the number of students and total marks as input parameters.