Choose the correct protein sequence that would result from the following DNA template sequence using the table below: 3'-TACAAATTAAGTCTCGGGTTTACGATT- 5' Second letter U A G UUU -Phe UAU Tyr UGU UCU UCC UCA U UUC U UUA UGCCYS C UAA Stop UGA Stop A UAC Ser Leu UCG, UUG J UAG Stop UGG Trp CUU CỤC CCU) ССС ССА CCG CGU CGC Arg CAU1 His САС. CAA Leu Pro CUA CGA CUG CAG GIn CGG AAU Asn ААС. AGU Se AUU ACU AUC le А AUA АСС АCА AGC Thr AGAJArg AAA A AUG Met ACG | AAGLYS AGG. G GUU) GUC · Val GCU GCC GCA GCG GGU GGC Gly GAU1 GACS Asp C Ala GUA GAA Glu GAG. GGA A GUG GGG G First letter JUAG Third letter

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…

A: Introduction  Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…

Q: Which 2 primers will copy the entire sequence of DNA: 5'…

A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC…

A: An Antisense DNA strand directed in 5’ to 3’ end is the non-coding DNA strand of a cell which acts…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: The DNA sequence you use will be the following:  T - A - G - C - C - A.  You will need to make the…

A: chargaff's rule states that in DNA sequence in  complementary strands the Adenine will form a bond…

Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…

A: To identify: The mutation in the given DNA sequence

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: What would the amino acid sequence be for the following DNA Transcript?…

A: DNA is the molecule that stores the information for the coding of the protein sequences in the human…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: #4 BamI --- 5’ CCTAG ↓G 3’    5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’  3’…

A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence:…

A: When a single base nucleotide is changed, it is called as point mutation.  Non sense mutation, is a…

Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…

A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…

Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA  3' CCC…

A: The genomic structure of an organism consists of DNA which contains sugar molecule, phosphate group,…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…

A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Shown here is a DNA sequence. Which strand is the template?…

A: There are two types of strands in transcription process of the eukaryotic DNA  Template strand…

Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…

A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…

Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…

A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…

A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…

Q: From the following DNA template, which sequence is synthesized by RNA Polymerase?    5’- T  – C – C…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…

A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…

Q: The following bacterial DNA genome is composed of three sequences: TGGCGGT / ACGTTAC / GGATAGG Using…

A: Clustered regularly interspaced short palindromic repeats or CRISPR is a family of nucleotide…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP…

A: Sanger method of DNA sequencing is a chain termination method of DNA sequencing in which…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…

A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…

Q: plz explain with thorough explanation

A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…

Q: List the sequences of RNA that would be transcribed from the following DNA template sequences.…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that…

Q: An original DNA sequence retrieved from the gametes of a female Golden Retriever and a mutated DNA…

A: DNA is two stranded structure , present bin double helix and is a genetic material in most of…

Q: The following fragment of DNA is from the template strand. First determine the amino acids of the…

A: DNA -> Transcription -> mRNA -> Translation -> Protein Transcription is the synthesis of…

Q: If you have got the following DNA templatemolecules, which one of them will require more energy to…

A: The separation of two antiparallel strands of DNA is dependent on GC content of DNA. G is guanine…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: Amino acids are the amine groups consisting of carboxylic acids and a side chain which forms the…

Q: For the following short sequence of double stranded DNA and the given primers, there will be one…

A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…

Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand…

Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…

A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…

Q: 3 HaelII --- 5’ CC ↓ GG 3’   5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’…

A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Given Sequence:

A: The genetic information stored in a cell is transcribed into a messenger RNA by the process of…

Stress

Stress is defined as the feeling of being overwhelmed or unable to cope with emotional or mental pressure. Any event or action that makes a person annoyed, furious, or nervous can trigger it. Chemical changes in the body caused by stress can cause blood pressure, blood sugar levels, and heart rate to rise.