The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP Pentanucleotide trinucleotide mononucleotide Dinucleotide Hexanucleotide Octanucleotide tetranucleotide Heptanucleotide nonanucleotide What is the sequence of the template DNA? A. 3'-GAGTTCAGC-5' B. 5'-GAGTTCAGC-3' С. 3-СТСААGТCG-5' D. 5-СТCААGТCG-3' E. 5'-CUCAAGUCG-3'

The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP Pentanucleotide trinucleotide mononucleotide Dinucleotide Hexanucleotide Octanucleotide tetranucleotide Heptanucleotide nonanucleotide What is the sequence of the template DNA? A. 3'-GAGTTCAGC-5' B. 5'-GAGTTCAGC-3' С. 3-СТСААGТCG-5' D. 5-СТCААGТCG-3' E. 5'-CUCAAGUCG-3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a DNA strand that starts with the sequence 3′-CGTATATCCCTACGTTGG-5′ (consider the strand about 100-nucleotide long). You try your sequencing reaction three times, but every time you make a mistake, as indicated below. What would be the outcome in each case? Justify your answers. (a) You forgot to add dCTP (b) You forgot to add ddCTP (c) Your primer is complementary to two regions in the DNA to be sequenced.
With regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy nucleotides are fluorescently labeled.b. The dideoxy nucleotides cannot be incorporated into a growingDNA strand.c. When incorporated into a DNA strand, the dideoxynucleotidesprevent further growth of the strand.d. The dideoxy sequencing method is used to determine the basesequence of DNA.e. The dideoxy sequencing method requires the use of primers.
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate—say, ddCTP—is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What resultwould be observed if the dCTP were omitted?
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many sequence reactions by insertion of a dideoxynucleotide B):Random stopping of one of many sequence reactions by insertion of a deoxynucleotide C):Random initiation of one of many sequence reactions by insertion of a dideoxynucleotide D):Having at least two dideoxynucleotides per chain E):The inability of DNA polymerase to incorporate a dideoxynucleotide
In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to measure DNA, and _______ to measure protein. The ratio _______ is then calculated, and a number between _______ indicates higher purity. 280 nm; 260 nm; A280/A260; 0.5-1 260 nm; 280 nm; A260/A280; 0.5-1 260 nm; 280 nm; A260/A280; 1.5-2 260 nm; 280 nm; A280/A260; 1.5-2
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?
A student is running gels to sequence a DNA fragment as below. In addition to running four sequencing reactions with the requisite ddNTPs, they also include four ‘mystery’ reactions representing variants of the first sequencing lane (using ddATP to sequence T in the template) in which one or more components of the reaction have been omitted or inappropriately added. Give a possible explanation for the what was inappropriately added/omitted in each mystery lane. Note two important things: firstly, even if everything works perfectly there is still always some unextended primer in a reaction. Secondly, there may be more than one possible explanation for some lanes; just give one.