What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed
Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…
A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…
Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…
A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: Answer: Central Dogma : It is the complete process of replication of DNA, transcription of DNA to…
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: Normal sequence: DNA: MRNA: GGA CCU prline CTC GAG glutamic acid CTC GAG glutamic acid Amino Acids:…
A: Normal sequence: DNA: GGA CTC CTC mRNA: CCU GAG GAG Amino Acids: proline glutamic acid glutamic…
Q: Sickle cell hemoglobin DNA CACG T AGACTGAGGA CAC Sickle cell hemoglobin MRNA ickle cell hemoglobin…
A: According to the question, we have to mention the type of mutation present in Sickle cell anemia…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Central dogma is the process where in the information stored in nucleic acids is transferred to…
Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…
A: To identify: The mutation in the given DNA sequence
Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…
A: Disclaimer: " It is assumed that the given coding strand is from 5' to 3' direction. The central…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…
A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA. Missense…
Q: Normal DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC mRNA: Animo Acid: 1st Mutation TGC GTG…
A: Mutations are sudden irreversible changes in the DNA sequence that arise due to ionizing radiations,…
Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…
A: The central dogma is referred as the central processing system which includes the transfer of…
Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…
A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…
Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…
A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…
Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…
A: The Genetic code is : 1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…
Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…
A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…
Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…
A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: How do I determine the eventual amino acid code from: 3' TACCCCGGGTTTCAACATG 5' -(TEMPLATE STRAND)…
A: In double stranded DNA , one strand is known as template strand and other one is the coding strand.…
Q: In E. coli, RecBCD complex has (select all correct answers) endonuclease activity а. O b. DNA…
A: RecBCD is a enzyme of e.coli which is required to repair thier DNA. RecBCD has many components and…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…
Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…
A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…
Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…
A: We are answering four parts For rest of parts pls repost.
Q: Why is it important that the correct reading frame is used?
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…
A: The process of copying the information in a strand of DNA to produce an mRNA is called…
Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct…
A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…
Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…
A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…
A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…
Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…
A: Within the biological system, the flow of genetic information is explained as molecular biology's…
Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…
A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…
Q: Frameshift Insertion Mutation – Can be one or more nucleotides. 5’ ATG GGG AAA GAT TAT…
A: Any heritable change in an individual's genetic makeup is referred to as a mutation. It's when a…
Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: What is the sequence of the mRNA transcript that will be produced from the following sequence of…
A: Transcription is the process of synthesis of RNA from DNA. RNA polymerase catalyzes this process by…
Q: Transcribe and Translate the following DNA. Be sure to label which sequence is your transcript and…
A: The Central Dogma is the process by which the DNA is ultimately produce a polypeptide chain or…
Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…
Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…
A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…
Q: DNA 1RNA MRNA AA Sequences GGC CIG GTT AAA TGG CCG GAC CAA T ACC GGC CTG GTT AAA TGG GLY LEU VAL LYS…
A: The base pairing of DNA and RNA differ slightly in their nucleotide bases. DNA uses the bases…
Q: Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There…
A: mRNA is the abbreviation for messenger RNA, a type of single-stranded RNA involved in protein…
Q: Which of the following sequences would most likely be able to bind a Cyclic AMP DNA binding protein?…
A: Cyclic AMP or cAMP is one of the most important secondary messenger prevalent in biochemical signal…
Q: Gly Leu (F) (L) Glu Asp (D) Ser (S) Tyr Ala (A) GUC Cys (C) G U Val (M) U GNP (W). Arg (R) G A C Leu…
A: Any change in the genetic material, which is not caused by recombination, that leads to altered…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: Transcription is a process through which the double stranded DNA transcribes itself into a single…
Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…
A: During protein synthesis, the nucleotide sequence of the mRNA is read in the form of triplets.
What would the amino acid sequence be for the following DNA Transcript?
5’AAGCCATTTAAAGGC 3’
3’ TTCGGTAAATTTCCG 5’
- Phe Gly Lys Phe Pro
- Phe Leu Lys Phe Val
- Lys Phe Phe Lys Pro
- Lys Pro Phe Lys Gly
- More information is needed
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING: a.Complementary Strand: b. Direct Transcript: c. Transcript for Translation: d.Translated Amino Acid Sequence:
- Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGWhich of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.
- 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitutionThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
- Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?