Concatenate two strings using pointers and dynamically allocating the memory for the results. Read two strings from the keyboard using the fgets function. Dynamically allocate the memory for the result using malloc function. Using pointers, copy the first string to the result , except the null terminator ( ’\0’) from the end from the first string. Copy the second string to the result, including the null terminator. Print your results. Free up memory with the free function. Use valgrind to check memory usage.

Which of the following are true? O The C-library has many functions that are useful in manipulating strings. V If a and b are two different C-string variables, the value in a can be assigned the value in b with the following C-statement: a = b; %3D O The length of the char array holding the string must be at least one character longer than the string itself. O An array identifier cannot be used as a pointer. V The identifier, name, of a C-string is also a pointer to a char data type. The ending character in a C-string must be the newline character, '\n'. O The name of a 1-D array is a pointer to the data type of the array, while the name of a 2-D array is a pointer to a 1-D array of the data type.

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

Game of Hunt in C++ language   Create the 'Game of Hunt'.  The computer ‘hides’ the treasure at a random location in a 10x10 matrix. The user guesses the location by entering a row and column values. The game ends when the user locates the treasure or the treasure value is less than or equal to zero. Guesses in the wrong location will provide clues such as a compass direction or number of squares horizontally or vertically to the treasure. Using the random number generator, display one of the following in the board where the player made their guess: U#  Treasure is up ‘#’ on the vertical axis (where # represents an integer number). D# Treasure is down ‘#’ on the vertical axis (where # represents an integer number) || Treasure is in this row, not up or down from the guess location. -> Treasure is to the right. <- Treasure is to the left. -- Treasure is in the same column, not left or right. +$ Adds $50 to treasure and no $50 turn loss. -$ Subtracts…

In order to declare a pointer, the ""&"" (ampersand) symbol is used."  True  False