Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Seals the gaps between the lagging strands to create one continuous DNA. [ Select ] [ Select] DNA gyrase primer peptidyl transferase aminoacyl tRNA synthetase sigma factor DNA polymerase III single stranded binding proteins helicase ligase RNA polymerase primase sliding clamp Not saved codon DNA polymerase I antisens strand
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Another…
A: Asked: Another term for template strand in transcription
Q: Which of the following features is common to both DNA replication and RNA transcription? Both…
A: Nucleic acids, made up of nucleotide bases, as deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates…
A: DNA replication is defined as the process by which a molecule of DNA is replicated or duplicated.…
Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer…
A: DNA replication is the process of synthesis of new DNA molecules from the existing ones.
Q: To test whether you understand the processes involved in the Central Dogma of Molecular Genetics,…
A: The DNA is the genetic material in living organisms that contain specific nucleotide sequences. The…
Q: Which of the following enzymes can recognize and remove a damaged DNA base to leave an apurinic or…
A: There are different types of repair system in body which repairs damage DNA.
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: the coding strand is given in the question which will replicate to form a template strand. Then…
Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome…
A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…
Q: Polymerase chain reaction is— a reaction involving a chain of different types of polymerases…
A: PCR is a technique to make many copies of DNA in vitro. It relies on thermostable Taq polymerase and…
Q: DNA polymerase I DNA polymerase II DNA ligase Primase RNA primer 5' Lagging strand 3' 3' Okazaki…
A: The process of copying of double stranded DNA by the application of several Enzymes and proteins…
Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In…
A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…
Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…
A: Transcription is the process in which m RNA is synthesized and the translation is the process in…
Q: Human Fbh1 helicase is important in the process of DNA replication. When a muta occurs during the…
A: Introduction : 1) DNA replication is the process by which the genetic material is copied within the…
Q: Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments…
A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…
Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA…
A: The principal method utilised by mammals to remove bulky DNA lesions such as those caused by UV…
Q: The schematic diagram below shows the functional organization of transcribing RNA polymerase. Match…
A: Transcription is the next step after replication in the central dogma of biology. It is the process…
Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA…
A: Point mutation : It occurs as result of replacement of one nucleotide by other. point mutation bring…
Q: At a specific area of a chromosome, the sequence of nucleotides below is present where the chain…
A: Replication is the process of making of daughter DNA from the parental DNA.
Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?
A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…
Q: Which of the following processes of genetic information flow can occur under lab conditions, but has…
A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: This…
A: In prokaryotic DNA replication , the DNA copies it DNA and transfer the copy of DNA into daughter…
Q: 2)For each item in the following table, decide whether it is related or involved in transcription,…
A: DNA is better represented by the central dogma of biology, which is transcribed to RNA, which is…
Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…
A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…
Q: Which of the following are similar characteristics shared between DNA replication and transcription?…
A: Introduction :- Replication is the process of synthesis of the DNA molecule . It occurs in S (…
Q: Match the following (most appropriate combinations): helicase Topoisomerase DNA Polymerase III DNA…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…
Q: a. What process would be unaffected in with defective topoisomerase? Prokaryotic DNA packaging…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…
A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'
Q: Summarize the functions of the following proteins in E. coli DNA replication: DNA polymerase I, DNA…
A: Introduction: DNA is the hereditary material for living cell which transfer from parent cell when…
Q: Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Which statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA…
A: The replication of DNA (deoxyribonucleic acid) occurs in a semi-conservative mode. In this mode, the…
Q: Which of the following processes of genetic information flow can occur under laboratory conditions,…
A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…
Q: During eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a…
A: In the DNA replication a double stranded DNA atom is duplicated to deliver two indistinguishable…
Q: From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C…
A: According to the central dogma of molecular biology, the information stored in DNA is first…
Q: Which of the following enzymes ensures that the correct base of a deoxynucleotide for growing the…
A: DNA replication is the process of duplicating a DNA molecule. Every time a cell divides, it must…
Q: In eukaryotes, primers generated during DNA replication are made of _____________ and are removed by…
A: Given here are some of the statements regarding DNA replication:- following is the correct option…
Q: How is DNA copied with leading and lagging strands? Please use these terms in a summary: Helicase…
A: DNA is the molecule which comprises of two polynucleotide chains that wound around each other for…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Origin of replication [ Choose ] [ Choose ] Codon Complementary pairs with cytosine in a DNA…
A: Central dogma explains the flow of genetic material in an individual. It tells how the information…
Q: Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: Discuss DNA replication of prokaryotes and please mention all of the enzymes and components listed…
A: DNA Replication mechanism The process of replication in living cells requires a set of enzymes. The…
Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? A. DNA…
A: DNA A deoxyribonucleic acid polymer that present in the nucleus and carry genetic information.
Q: A researcher combines a variety of molecules needed for DNA replication. After adding DNA to the…
A: The correct option is (A) DNA ligase
Q: Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’…
A:
Q: A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You…
A: A Deoxyribonucleic acid (DNA) synthesizer machine used for generating shorter segments of DNA that…
Q: Match these replication associated terms with the appropriate definition or function. DNA consensus…
A: DNA replication is the process of making two identical copies of DNA from one single parent DNA.
Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…
A:
Q: A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation…
A: DNA replication adopts a semi - conservative pattern. Each of double helix's strands serves as a…
Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase…
A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…
Q: Which of the following statements is/are TRUE for both replication and transcription? Polymerase…
A: DNA replication is the biological process of producing two identical copies of DNA from a double…
Q: In a bacterial cell one enzyme overwinds DNA to create supercoiling, while a second enzyme unwinds…
A:
![Consider prokaryotes, choose the CORRECT enzyme/keyword for the following
function/role:
Seals the gaps between the lagging strands to create one continuous DNA.
[ Select]
[ Select ]
DNA gyrase
primer
peptidyl transferase
aminoacyl TRNA synthetase
sigma factor
DNA polymerase III
single stranded binding proteins
helicase
ligase
RNA polymerase
primase
sliding clamp
codon
Not saved
St
DNA polymerase I
antisense strand](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F0ebba1cb-7b8d-4edb-a729-eb45140da03b%2F5dc4668a-6dfc-45d7-a0b7-83b3bb456c41%2Fd9fn75_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps
- Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
- The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’Transcribe and translate the following DNA sequence (nontemplate strand); 5GCATGCGCGGCCATGTTGATTAAGCA 3Show and label the ends of your code for each step.
- Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).