Consulting Table 4.1, determine the length and the nature (59 or 39) of the overhang (if any)created by the following restriction endonucleases:a. Alulb. Bglllс. Clald. Кpnle. Mbolf. Pyulg. Not!Table 4.1 Recognition Sequences and CuttingSites of Selected RestrictionEndonucleasesEnzymeRecognition Sequence*AlulAGICTBamHIGIGATCCBgl|AIGATCTClalATICGATEcoRIGIAATTCHaelllGGICCGTPY I Pu A CALAGCITHindllHindllНраllCICGGKpnlGGTACICMbolĮGATCPstlCTGCALGPvulCGATICGSallGITCGACSmalCCCIGGGXmalCICCGGGNotlGCIGGCCGC*Only one DNA strand, written 5'3' left to right is presented, but restrictionendonucleases actually cut double-stranded DNA as illustrated in the text for EcoRI.The cutting site for each enzyme is represented by an arrow.

Restriction endonucleases are enzymes utilized in domain of genetic engineering for various…

Consulting Table 4.1, determine the length and the nature (59 or 39) of the overhang (if any) created by the following restriction endonucleases: a. Alul b. BglII c. ClaI d. Kpnl e. Mbol f. Pxul g. NotI Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Recognition Sequence* Alul AGICT BamHI GIGATCC Bgll AIGATCT Clal ATICGAT EcoRI GIAATTC Haell GGICC Hindll GTPY I Pu AC Hindll AJAGCIT Нрall CICGG Kpnl GGTACIC Mbol ĮGATC Pstl CTGCALG CGATICG GITCGAC Pvul Sall Smal CCCIGGG Xmal CICCGGG Notl GCIGGCCGC

Consulting Table 4.1, determine the length and the nature (59 or 39) of the overhang (if any) created by the following restriction endonucleases: a. Alul b. BglII c. ClaI d. Kpnl e. Mbol f. Pxul g. NotI Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Recognition Sequence* Alul AGICT BamHI GIGATCC Bgll AIGATCT Clal ATICGAT EcoRI GIAATTC Haell GGICC Hindll GTPY I Pu AC Hindll AJAGCIT Нрall CICGG Kpnl GGTACIC Mbol ĮGATC Pstl CTGCALG CGATICG GITCGAC Pvul Sall Smal CCCIGGG Xmal CICCGGG Notl GCIGGCCGC

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 23QP

See similar textbooks

Similar questions

As you learned in this chapter,restriction enzymes are sophisticated“scissors” that geneticistsand molecular biologists routinelyuse to cut DNA for recombinant DNAexperiments. A wide variety of onlinetools assist scientists working with restrictionenzymes and manipulating recombinantDNA for different applications. Herewe explore Webcutter and Primer3, twosites that make recombinant DNA experimentsmuch easier.Exercise I – Creating a RestrictionMap in WebcutterSuppose you had cloned and sequenceda gene and you wanted to design a probeapproximately 600 bp long that could beused to analyze expression of this gene indifferent human tissues by Northern blotanalysis. Internet sites such as Webcuttermake it relatively easy to design experimentsfor manipulating recombinant DNA.In this exercise, you will use Webcutter tocreate a restriction map of human DNAwith the enzymes EcoRI, BamHI, and PstI.1. Access Webcutter at http://www.firstmarket.com/cutter/cut2.html.Go to the Study Area for…
How does that length compare to that of restriction enzymes? Implications? 2. can you conceive of any potential applications of CRISPR technology?
Whole-exome sequencing (WES) is helping physicians diagnosea genetic condition that has defied diagnosis by traditionalmeans. The implication here is that exons in the nucleargenome are sequenced in the hopes that, by comparison withthe genomes of nonaffected individuals, a diagnosis might berevealed. What are the strengths and weaknesses of this approach?
Do virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence and explain why. Tip: The plasmid map is showed below, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader
Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.
show your rationale How many RT-PCR products generated from 13 copies of mRNA (= cDNA) from 33 PCR amplification cycles? What was the original starting number of mRNA molecules if after 36 PCR cycles, the reaction had generated 996,432,412,672 copies?
The recognition sequence for the restriction enzyme Sau3AIis GATC; in the recognition sequence forthe enzyme BamHI—GGATCC—the four internal bases areidentical to the Sau3AI sequence. The single-stranded endsproduced by the two enzymes are identical. Suppose youhave a cloning vector that contains a BamHI recognitionsequence and you also have foreign DNA that was cut withSau3AI. Can this DNA be ligated into the BamHI site of the vector,and if so, why?
Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel sequencing platform is quite expensive. However, a way to circumvent this cost issue is to pool and sequence more than one sample. How would you be able to distinguish and identify the reads from different samples?
Q.1. Imagine you are working for a research laboratory and you are asked to help withthe following:a. Cut the following segment of DNA using E. Co R I. Write the sequence offragments clearly and separately. ATTTACGAATTCTTCCAAGAATTCCTAAATGCTTAAGAAGGTTCTTAAGG b. Show sticky ends? How restriction endonuclease are different from the restriction-modification system?
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?