
Concept explainers
Create a program that can accept input numbers array 1 and array 2 with the same length, then the program has a function that can multiply the two arrays and then display the value.
Use the C ++

Each element of arr1 is multiplied with respective element of arr2
#include <iostream>
using namespace std;
void multiply(int* arr1, int* arr2, int n){
int result[n]; //declare an array to store result
cout << "The multiplication of elements is: ";
for(int i=0; i<n; i++){ //i from 0 to n
result[i]= arr1[i]*arr2[i] ; //multiply values in each index
}
for(int i=0;i<n;i++){ //i from 0 to n
cout << result[i] << " "; //display value at index i seperated by space
}
}
int main()
{
int n;
cout << "Enter the number of elements in array: ";
cin >> n; //input number of elements in array
int arr1[n],arr2[n];
cout << "Enter the elements of arr1: ";
for(int i=0;i<n;i++){ //i from 0 to n
cin >> arr1[i]; //input values into arr1
}
cout << "Enter the elements of arr2: ";
for(int i=0;i<n;i++){ //i from 0 to n
cin >> arr2[i]; //input values into arr2
}
multiply(arr1,arr2,n); //call multiply function
return 0;
}
Step by stepSolved in 3 steps with 1 images

- c++ programming Initialize a string array named person with your first, middle andlast name as separate elements. Print the middle name from the array. Iterate to print all values of the array. Output Example WilliamJohn William Henryarrow_forwardCreate a c programming flowgorithm chart for the following: You must use at least two different arrays A character array to store the welcome message (note: when creating your flowchart you will need to declare this message with the string data type as a variable and assign the message). Use the puts() function to display the message to the screen. An array with a float datatype to store the prices of the items Prompt the user to enter how many items they have to total. Use a for() statement to fill the array using the value the user entered as the end point of the loop. Use an accumulating total statement to compute the total sales There is a constraint - if the price of any one item is greater than $10.00 it is considered invalid, you must use a repetitive statement to display a message and force the user to enter a value less than $10.00 You need to create a function to compute the final total using a sales tax of 6% (.06)arrow_forwardUsing either pseudocode of C++ code, write a function that takes three parameters and performs a sequential search. The first parameter is an array of integers. The second parameter is an integer representing the size of the array. The third parameter takes the value to be search form. The function should return the subscripts at which the value is found or -1 is the array does not contain the search term. Please dont use vectors and explain each steparrow_forward
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardSee attached images C++arrow_forwarduse c++ Programming language Write a program that creates a two dimensional array initialized with test data. Use any data type you wish . The program should have following functions: .getAverage: This function should accept a two dimensional array as its argument and return the average of each row (each student have their average) and each column (class test average) all the values in the array. .getRowTotal: This function should accept a two dimensional array as its first argument and an integer as its second argument. The second argument should be the subscript of a row in the array. The function should return the total of the values in the specified row. .getColumnTotal: This function should accept a two dimensional array as its first argument and an integer as its second argument. The second argument should be the subscript of a column in the array. The function should return the total of the values in the specified column. .getHighestInRow: This function should accept a two…arrow_forward
- Programming Language: C++ Please use the resources included and provide notes for understanding. Thanks in advance. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE]; fill(team, SIZE);findWinner(team, SIZE); return…arrow_forwardProgramming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…arrow_forwardProgramming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replacearrow_forward
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education





