Describe the amino acid composition in terms of the general characteristics and comment on what the amino acid composition tells you about likely cellular location of the protein.
Q: What is the pH of a buffer that contains 0.9 M ammonia and 0.3 M ammonium ion? (Ka for ammonium ion…
A: The objective of this question is to calculate the pH of a buffer solution containing ammonia and…
Q: Structure B was derived from structure A. What was the main reason for incorporating the two ester…
A: A molecule gains hydrolysis-prone sites when ester groups are incorporated into it. Choline is…
Q: The enzyme that catalyzes the formation of the peptide bond is located: in the large ribosomal…
A: During translation amino acids get linked to each other via peptide bonds. The enzyme responsible…
Q: ou are studying the tripep de Lys-Val-Thr. a) Could you use the absorbance at 280 nm to determine…
A: Protein concentration can be determined using spectrophotoscopy. Here, the absorbance of a protein…
Q: Explain the underlying biomechanical constructs of spring, change of direction, and agility…
A: Spring-like biomechanical constructs refer to the ability of muscles and tendons to store and…
Q: How do glucagon and epinephrine affect glycogen in the liver? They increase both glycogen breakdown…
A: Glucagon is a polypeptide hormone secreted by the alpha cells of Iselets of pancreas. Glucagon is…
Q: (a) AG for transport of a proton from the mitochondrial matrix (inside) to the intermembrane space…
A: Where,C( inside)= Concentration of H+ ions inside the mitochondrial matrixC(outside)= Concentration…
Q: Genetics Question 1
A: The objective of the question is to determine which inheritance pattern can be eliminated based on…
Q: Genetics Question 7
A: The question is asking about the possible origins and consequences of spontaneous mutations in…
Q: An incomplete structure of a porphyrin ring is shown below. The structure is missing three pi bonds…
A: Porphyrin molecules are a popular biological moiety with applications in pharmaceutical chemistry,…
Q: imagine that you are running a sample on the HPLC that is comprised of aspartate and isoleucine.…
A: Chromatography is a separation technique that separates a mixture of analytes based on their…
Q: 25. The AG" values for the two reactions are given. 1. 2. oxaloacetate + acetyl-CoA + H₂O → citrate…
A: The objective of the question is to determine the ΔG°' for the hydrolysis of Acetyl-CoA. This can be…
Q: Is the following process considered oxidation or reduction? a oxidation b reduction Fe²+ Feº
A: Oxidation and reduction are fundamental concepts in chemistry that describe the transfer of…
Q: What is the difference in ATP yield per glucose molecule between the malate-aspartate shuttle and…
A: During glycolysis of glucose, 1 molecule of glucose yields 2 molecules of NADH. The high energy…
Q: Proteases are one of the main drug targets. Choose the False statement regarding proteases. A.…
A: Proteases are a group of enzymes with a catalytic function to hydrolyze ( a reaction where water…
Q: 31.A) What is the overall order of an enzymatic reaction, under conditions where the substrate…
A: Km is the Michaelis menton constant which is equal to Substrate concentration at which the velocity…
Q: Plot based on chart
A: Standard curve or plot is the graph that is absorbce vs known concentration of proteins. This graph…
Q: Which of the following is true of the difference between Class I and Class II B-lactamase…
A: Beta lactamase inhibitors are the substances or compounds that inhibit beta lactamase enzymes. Beta…
Q: 5. What is a saponification number? What does a high saponification number indicate? Name a lipid…
A: Biological macromolecules are the molecules that are required in sufficient quantity for the…
Q: b. Which variant would be most effective at measuring changes in the concentration of TNB in regions…
A: There is a protein that binds maltose (a carbohydrate). It is called maltose binding protein.…
Q: a.Write the balanced reactions catalyzed by complex I, II, III, and 1V, and using these, write the…
A: The electron transport chain (ETC) involves the transfer of protons between the matrix (the negative…
Q: complete steps of haworth projection of D-tagatose
A: If the OH of the bottom most chiral center of the fisher projection of a monosaccharide is placed…
Q: Mutations in adenylate kinase have led to a hyperactive enzyme that ultimately ends up elevating ADP…
A: Given ATP = 0.5 mMADP = 12.2 mMAMP = 80uM
Q: Fatty Acids-Draw out one fatty acid from the list given in class. Hydrocarbon chain atoms do not…
A: Fatty acids are carboxylic acids and structural components of lipids. Fatty acids are generally…
Q: expanded structure of the D-tagatose Fischer projection of D-tagatose Haworth projection of…
A: The objective of the question is to understand the different structural representations of…
Q: Question 4 Listen A gene known as H is epistatic to the ABO blood type genes. Based solely on this…
A: The question is asking us to determine which of the given options is possible based on the statement…
Q: When the CAC is run in reverse by microorganisms that use it to fix carbon, the citrate synthase…
A: Kreb cycle is the reaction procews that operates in the mitochondria and it is followed by…
Q: addition to L-lactate, which of the following molecules is (are) generated by fermentation of…
A: Fermentation is an anaerobic process that occurs in the absence of oxygen, leading to the conversion…
Q: In some microorganisms, carbon fixation occurs by reversal of the citric acid cycle. This reversal…
A: Change in standard reduction potential () is the standard reduction potential of the electron…
Q: Please fill in the four boxes bolded below you KM (MM) Vmax (nM/s) Type of inhibition…
A: Competitive inhibitors are the substances which are similar to substrate molecules in their…
Q: Mark any/all that apply to uncompetitive inhibition: Group of answer choices: None of these is…
A: The enzyme inhibition which is also known as anti-competitive inhibition is characterised by change…
Q: GQ 4
A: The objective of the question is to determine the probability of Diane's next son being colorblind,…
Q: GQ6
A: The objective of the question is to identify the phase of cell division in which an even number of…
Q: Since two 19S regulatory subunits and a 20S catalytic unit constitute the 26S proteasome, why is the…
A: A peptide is a short chain of amino acid residues linked together via peptide bonds. A folded…
Q: Why is the NAD+/NADH pairing so effective in biochemical redox reactions? A The reactions occur…
A: NAD+ /NADH pairing means the interconversion between nicotinamide adenine dinucleotide (NAD+) and…
Q: Directions: Answer the following as directed: vinu oto de 00 200nsko2 brs 2nA lo epello 1. After…
A: Amino acids are building blocks of proteins, which have three different chemical groups: an amino…
Q: Which of these situations would produce a Hill plot with a Hill coefficient less than 1? A purified…
A: A Hill plot is used to establish the cooperativity of ligand binding to a protein.NH (Hill…
Q: What value of [S], as a fraction of KM, is required to obtain 80% of Vmax? (Hint: use the MM…
A: We need to use the Michaelis-Menten (MM) equation shown below to solve this question.
Q: An XXX can occur by all of the following except An error in meiosis 1 in the mother of the…
A: There are 2 sex chromosomes in humans. In males, there is an X and a Y. In females, there are 2 X…
Q: . If 20 mM solution of Acetyl-phosphate is transformed to acetate by incubating with a catalytic…
A: Initially there was 20 mM acetyl-phosphate. At equilibrium, the acetyl-phosphate concentration…
Q: Using the information given, determine the Kd for the binding of HABA to BSA. B= y-intercept (E…
A: Y=mx+b is the equation of a line that is not passing through the origin. In this equation, m is the…
Q: Please mark my multiple choice paper: Mark the INCORRECT alternative concerning the Introduction to…
A: Since you have posted multiple questions, we would answer the first three questions. Please repost…
Q: I want to make a buffer solution containing 1 M glycene pH = 10 (Na+), 1 mM ZnCl2 , 1 mM MgCl2. I…
A: The objective of this question is to calculate the volume of each stock solution needed to prepare a…
Q: Which of the following statements is true for miRNA but not siRNA? Formed from an RNA transcript…
A: miRNA is nothing but micro RNA which is 18-25 nucleotides long where as si RNA is smaller…
Q: Select the incorrect statement. With regards to free energy ΔG of the reaction below E+S ⇌ ES…
A: ∆G is the difference in free energy in a reaction between reactants and products. ∆G° is the change…
Q: Determine whether each of the examples or phrases describes an essential amino acid, a nonessential…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Draw a ribbon structure for the following polypeptide: (There is more than one right answer to this…
A: The polypeptide in question is likely to form intrastrand antiparallel beta-sheet. Beta-sheets are…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Q: Patch clamp recording of a single ion channel yields the following results: Holding…
A: Ion channels are proteins that allow charged ions to pass through them. When a permeable membrane…
Q: N - Leucine - Arginine - Proline - Aspartic acid - Methionine - C write the structure classify the…
A: Peptides are composed of amino acids that are bonded to each other via peptide bonds. The ionizable…
Describe the amino acid composition in terms of the general characteristics and comment on what the amino acid composition tells you about likely cellular location of the protein.
Step by step
Solved in 3 steps
- Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.>mutant1…Rice genome contains 30% C on a molar basis. What are the mole percentages of A, G, and T?
- The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDaFor each individual on gel, determine if the individual is homozygous for presence of the Alu insertion (++), heterozygous (+-), homozygous for the absence of the Alu insertion (- -), or if the results are inconclusive (I) (explain in detail what leads to your determination of each individual on the gel and why). Explain what may have caused any unexpected bands (neither 850 nor 550) lack of bands.Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of making a perfect protein of 100 residues.(b) Repeat for a 1000-residue protein.
- The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?Beer's Law to determine Protein Concentration You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be1.35. Calculate the molar and mass concentration of the purified protein if the extinction coefficientand molecular weight of p53 is 35,410 M-1 cm-1 and 43,653 Da, respectively (l = 1 cm).GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.True/False: In general, weak promoters that support active transcription have -10 and -35 boxes that are close to the consensus sequences and a spacer between the two boxes that is 17 +/- 1 bp.You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be1.35. Calculate the molar and mass concentration of the purified protein if the extinction coefficientand molecular weight of p53 is 35,410 M-1 cm-1 and 43,653 Da, respectively (l = 1 cm).