The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefullyand using the following genetic code, translate the MRNA into an amino acid sequence.Second LetterUAGPhe uCuUC| Tyr UGUCys uUUUU UUCUUAUUGUAUUACUAAUAGUGCStop UGA Stop AStop UGG Trp GSerUCAUCGLeuCAUCACСААCAGCUCUHisCGUUc CucCUACUGLeu ccCCACGCGC ArgCGACGProGinA3rdG1stletterAUUSer u letterACUlle ACCACAAAUAsnAGUThr AACAAAA AUCAGCAUAAGA| LysAArgGAUGMet ACGAAGAGGAspGUUG GUCGUAGCUGAUGACGAAGGUGGC GlyVal |GCCGCAGCGAlaGGAGGGAGluGUGGAGGO Tyr-Val-ValO Asp-Tyr-lleO Leu-Met-TyrO lle-His-GlnO Asp-Thr-Leu-Tyr-Thr-His-lle星

Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Answered: de, translate the mRNA into an amino…

Science

Biology

de, translate the mRNA into an amino acid sequence.

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Related questions

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid ) is a…

Q: 3' AAAACTGTGCAT5'

A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…

Q: Briefl y describe the events in translation.

A: Translation is the process of formation of protein from the information containing in mRNA. It is…

Q: If an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAG

A: During translation the ribosome traverses over the mRNA in order to produce a peptide chain with the…

Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…

A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…

Q: Describe the synthesis and processing of mRNAs.

A: ANSWER;- mRNA is "courier" RNA. mRNA is synthesized in the core utilizing the nucleotide arrangement…

Q: Contrast the roles of tRNA and mRNA during translation, and list all enzymes that participate in the…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Describe the genetic code and how the nucleotide sequence determines the amino acid and the protein…

A: Genes are the unit of hereditary which are present in a thousand of numbers on the stand of DNA…

Q: If the sequence of bases in the coding strand of a DNA molecule isTAGC, then the sequence of bases…

A: Introduction The DNA/gene give rise to the formation of mRNA by the process called gene…

Q: Explain how rRNA is processed.

A: Ribosome biogenesis or the assembly of ribosomes involves more than 200 assembly factors and spreads…

Q: Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’

A: mRNA is read in 5' to 3' direction. Codons are triplet i.e. a combination of three bases codes for…

Q: Explain the process of translation.

A: mRNA is used to synthesise proteins during the translation process, which occurs during the process…

Q: Discuss the genetic code, and explain how it works withdifferent types of RNA to make a protein.

A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…

Q: Explain the process of transcription, and write complementary strands through mRNA.

A: Transcription is the first several steps of DNA based on gene expression in which a particular…

Q: Explain the function of transcription and translation.

A: Gene expression is the process by which the instructions in the DNA are converted into a functional…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: Construct an mRNA from a gene and then translate the mRNA into a protein using the genetic code

A: mRNA is produced as a result of transcription from a gene. It is a messenger RNA which is made up of…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.

A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…

Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.

A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…

Q: Examine the diagram below. At which times is translation but occurring? Production of a Particular…

A: The translation of the information contained in a mRNA (messenger ribonucleic acid) into an amino…

Q: Compare transcription to translation. Which of the process is mostly related to errors?

A: Transcription vs Translation Initiation- The transcription process is the beginning of the gene…

Q: Sequence of amino acids in protein

A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: Describe the key steps of translation

A: Translation is the process of polymerization of amino acids to form a polypeptide. The order and…

Q: Explain the process of mRNA to DNA translation

A: The second phase of protein production is translation. It happens after transcription when DNA…

Q: (c) With the indication of sense strand, template strand, the direction of transcription, provide…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Explain the translation with its stages.

A: All cells use replication, transcription, and translation to keep track of their genetic material…

Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…

A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: Briefly describe the events in translation.

A: The translation is one of the defined processes of the cell cycle. It is the last step in fact and…

Q: Describe the process of translation and transcription.

A: By activating the enzyme RNA polymerase, the DNA strand is converted into mRNA during the…

Q: Explain the process of TRANSLATION

A: DNA is the nucleic acid that stores genetic information.

Q: Write down some function of Mrna?

A: mRNA stands for messenger RNA. The process of the formation of messenger RNA from the DNA is called…

Q: Put the function of mRNA is blank

A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…

Q: Describe the relationship between the template strand of DNA, the codons inmRNA, anticodons in tRNA,…

A: Introduction:- The process of copying genetic information from one strand of DNA into RNA is termed…

Q: In details summarize the process of transcription.

A: Two questions are asked. I will answer first question, as per guidelines. Transcription The DNA…

Q: Describe the role of stop codons in the termination of protein synthesis.

A: Protein synthesis is a biological mechanism that occurs within cells to compensate for the loss of…

Q: Identify the features of tRNA that are important in decoding genetic information and converting it…

A: Codons encode specific amino acids for protein synthesis, a process known as translation. Transfer…

Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1

A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides. The code is…

Q: Describe the specificity between the amino acid carried by a tRNA and a codon in mRNA.

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Refer to the information on the genetic code. Use this information to determine how many amino acids…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: Summarize the mRNA translation steps of protein synthesis, which are: initiation, elongation, and…

A: Translation is the process of synthesis of proteins from mRNA.

Q: Examine the diagram below. At which times is transcription and not translation occurring? Production…

A: The phenotypic characteristics of an organism are controlled and regulated by its proteome, and each…

Q: If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was…

A: DNA sequencing is defined as the way of determining the sequence of nucleic acid by identifying the…

Q: Explain the process of Transcription and Translation.

A: Fragments of DNA that are responsible for different traits are known as genes. The expression of…

Q: Explain the process of mRNA to DNA translation.

A: Translation is the process of decoding the mRNA and building a polypeptide chain by the information…

Question

100%

The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully
and using the following genetic code, translate the MRNA into an amino acid sequence.
Second Letter
U
A
G
Phe uCu
UC
| Tyr UGU
Cys u
UUU
U UUC
UUA
UUG
UAU
UAC
UAA
UAG
UGC
Stop UGA Stop A
Stop UGG Trp G
Ser
UCA
UCG
Leu
CAU
CAC
САА
CAG
CU
CU
His
CGU
U
c Cuc
CUA
CUG
Leu cc
CCA
CG
CGC Arg
CGA
CG
Pro
Gin
A
3rd
G
1st
letter
AUU
Ser u letter
ACU
lle ACC
ACA
AAU
Asn
AGU
Thr AAC
AAA
A AUC
AGC
AUA
AGA
| Lys
A
Arg
G
AUG
Met ACG
AAG
AGG
Asp
GUU
G GUC
GUA
GCU
GAU
GAC
GAA
GGU
GGC Gly
Val |GCC
GCA
GCG
Ala
GGA
GGG
A
Glu
GUG
GAG
G
O Tyr-Val-Val
O Asp-Tyr-lle
O Leu-Met-Tyr
O lle-His-Gln
O Asp-Thr-Leu-Tyr-Thr-His-lle
星

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream leader sequences (c) downstream trailing sequences (d) start codon (e) promoter sequences
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).