Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC-GGC-TAC-CAT-ATG-GAG mrNa: tRNA: Amino acid sequence: 2. DNA Template: TTA-CAT-CAT-ATC-GAT-GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA-GCG- ATA - AAA-TTT-ATT mrNa: tRNA: Amino acid sequence:

Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC-GGC-TAC-CAT-ATG-GAG mrNa: tRNA: Amino acid sequence: 2. DNA Template: TTA-CAT-CAT-ATC-GAT-GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA-GCG- ATA - AAA-TTT-ATT mrNa: tRNA: Amino acid sequence:

Name: Convert the DNA template to mRNA. Then,convert the mRNA to tRNA. Based
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Convert the DNA template to mRNA. Then,convert the mRNA to tRNA. Based from theresulting sequence in the anticodons of tRNA,determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code.1. DNA Template: TAC-GGC-TAC

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence:
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
Give typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′
You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several different synthetic repeating mRNAs in translation reactions and analyze the sequences of the polypeptides produced from each reaction. The results are summarized below. mRNA sequence used: ...CACACACACACACAC... Polypeptide produced: ...His-Thr-His-Thr-His-Thr ...mRNA sequence used: ...CCACCACCACCACCA...Polypeptide produced: ...Thr-Thr-Thr... and ...Pro-Pro-Pro... and ...His-His-His...mRNA sequence used: ...ACAACAACAACAACA...Polypeptide produced: ...Thr-Thr-Thr... and ...Asn-Asn-Asn... and ...Gln-Gln-Gln... Based on these results, write what amino acid each codon below corresponds to. If there is not enough information to narrow down to one amino acid, write all the possibilities.CAC: ___________________________ ACC: ___________________________ ACA: ___________________________ CAA: ___________________________ CCA: ___________________________ AAC: ___________________________
Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Pro-Tyr Tyr-Gly-Met Val-Arg-Tyr Ile-Arg-Pro His-Ala-Ile Ile-Pro-Tyr Tyr-Gly-Met Val-Arg-Tyr Ile-Arg-Pro His-Ala-Ile
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
Use the mRNA coding chart above to answer these questions. he following is the base sequence on a portion of a template strand of DNA. 3 ‘ TACGCCAGTGGTTCGCAC 5 Give the base sequence of the complementary DNA strand. Give the base sequence of the strand of mRNA read from the original DNA template strand. List, in order, the amino acids that would be present in this protein? What would be the code that the methionine tRNA anticodon would carry? Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T. i) How would this change the protein? ii) What type of mutation is this?