The MRNA copy of the gene goes from the nucleus to the cytoplasm %3D The ribosome reads the instructions from the mRNA and builds a protein %3D RNA polymerase makes an mRNA copy of a single gene in the DNA %3D

The MRNA copy of the gene goes from the nucleus to the cytoplasm %3D The ribosome reads the instructions from the mRNA and builds a protein %3D RNA polymerase makes an mRNA copy of a single gene in the DNA %3D

Name: Put the steps of protein synthesis in order using this diagram to hel
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Put the steps of protein synthesis in order using this diagram to help youNudleusDNACytoplasmTranscriptionMRNARibosomeAminoAcidsTranslationThe MRNA copy of the gene goes from the nucleus to the cytoplasmThe ribosome reads the instructions from the M

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
twenty twoWalter Gilbert coined the term ( ) for a sequence that appears in a mature RNA. twenty threeThe ______________ pathway blocks mRNA translation or causes mRNA degradation. A.spliceosomeb.snRNAc.miRNAD.ribosome twenty fourGAL1 gene is switched on when galactose is added to remove the binding of ( ) to Gal4.
Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6) on space provided for; ____a. transcription ____b. tRNA amino acid ____c. amino acids separate from tRNA ____d. polypeptide chain assembled ____e. mRNA links to ribosome ____f. stop codon encountered in mRNA
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Imagine protein X, destined to span theplasma membrane. Assume that the mRNA carrying the geneticmessage for protein X has already been translated by ribosomesin a cell culture. If you fractionate the cells (see Figure 6.4), inwhich fraction would you find protein X? Explain by describingits transit through the cell.
19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yesorno 20Messenger RNA splicing and export are uncoupled processes. Yesorno twenty oneWhich of the following plays an important role in directing newly synthesized proteins to specific cellular destinations?A.signal sequenceb.nuclear localization signalc.chain elongation stretchD.Shine – Dalgarno
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
. While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’