Answered: Transcribe the following DNA strand…

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: CGATACAATGGACCCGGTATGCGATATCC ATA

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Related questions

Q: A DNA sequence can be represented as a string of the letters ACTG (short for , cytosine, guanine,…

A: The sequence of DNA defines the order of the four chemical building blocks called bases that make up…

Q: Describe the process of protein synthesis and localize where each step takes place. Use the…

A: Protein synthesis is one of the major processes, which helps in the synthesis of protein for the…

Q: DNA has the sequence GTA. If this were transcribed into mRNA, what would the RNA codon look like?…

A: Protein synthesis is a process by which a cell makes protein. It has two steps 1) Transcription,…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: Which of the following is not a DNA sequence? a. TAG b. AUGAUUCT d. AAAAAAAAAA e. CGG

A: DNA is also called deoxyribonucleic acid. DNA acts as genetic material for almost every organism…

Q: Transcribe the following DNA strand into MRNA and translate that strand into a polypeptide chain,…

A: DNA is made up of small units known as genes. These genes store all the hereditary information which…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…

Q: The process by which the genetic code of DNA is copied into a strand of RNA is called O translation…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: If a DNA strand has the sequence ATGCGATCCGC thenthe sequence on the complementary DNA strand is…

A: Answer is b.) TACGCTAGGCG.

Q: Whole DNA chromosomes are kept in the nucleus while small nucleotide monomers move into and out of…

Q: Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: Transcribe the DNA into RNA, then translate the RNA: DNA: 5’ TACGCAAAGCCAATGACT 3’ mRNA:…

A: The process of gene expression involves the transcription of the gene to produce an mRNA and then…

Q: If a strand of DNA has the sequence A T G C G A TC C G C, then the sequence of an mRNA…

A: DNA is made up of 4 bases A, T, G, and C. A Pairs with T and G pairs with C. In the case of RNA, the…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…

A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…

Q: Which of the following is true in translation? Codons on MRNA match to identical anticodons on tRNA…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: Write the sequence of the DNA strand complementary to the following strand:…

A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like?…

A: The sequence of bases on a DNA molecule GATTACA the mRNA sequence will be CUAAUGU. Option B

Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the…

A: DNA => Transcription => mRNA => Translation => Protein. Given: A DNA sense strand…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: Given the following DNA strand, which of the following is its complementary MRNA? G GACIGATT"…

A: Transcription and translation are two processes of gene expression. The process of the formation of…

Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…

A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: Introduction : The genetic code is the set of rules by which information encoded within genetic…

Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…

A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…

Q: Use the three letter code for amino acids. If they stop codon is encountered use the word stop…

A: A change in the DNA sequence is known as a mutation.

Q: Transcribe the following DNA sequence into RNA, and then into amino acids…

A: Transcription is the process by which the information stored is transcribed into mRNA. And…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: Nucleotides can be described as the nucleic acids’ building blocks. The two forms of nucleic acid…

Q: Given the following strand of DNA, find: 1. the complementary DNA strand 2. the mRNA 3. the TRNA 4.…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Compare the process of Replication, Transcription, and Translation by describing the following…

A: DNA is genetic material in most of the organism . It carries genetic information which is required…

Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…

A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…

Q: Which of the following choices best match the blank? Three-nucleotide segments of RNA called…

A: Amino acids are the monomers or structural units that are responsible for protein formation. The…

Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: What must be translated using the Genetic Code Table to decode a specific type of amino acid that…

Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…

A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…

Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…

A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…

A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…

Q: Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code

A: Codon is a trinucleotide sequence of nucleic acids which corresponds to specific amino acids.…

Question

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
ATA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: Codon: Anitcodon: Amino Acids:
transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: T A C G G G C C T A T A C G C T A C T A C T CA T G G A T C G G mRNA: Codon: Anitcodon: Amino Acids:
transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: T T T A C G G C C A T C A G G C A A T A C T G G mRNA: Codon: Anitcodon:
Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCAT
Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:
Transcribe the following strand into Mrna, then translate it into amino acids
A DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA molecule? 5’ AACGTAACG 3’ 5’ UUGCAUUGC 3’ 5’ TTGCATTGC 3’ 5’ UUGCAUUGC 3’
Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding sites, rRNAs, tRNAs, and codons.
Explain the process translation. A complete answer will include the words below tRNA, amino acid, polypeptide chain, ribosome, mRNA, codon, anticodon, nucleotides, base pairing rules, sequence
Use the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence.