Does cellular respiration occur in the cytoplasm or in the mitochondria? Explain and answer in digital format Make schematics and diagrams

Q: N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve first three…

Q: A glycocalyx functions in all of the folowing ways EXCEPT: a) adherence to non-living surfaces, such…

A: A glycocalyx is a loose sheet present around the bacteria cells.

Q: of macrophages?

A: Macrophages are tissue-resident or infiltrated immune cells critical for innate immunity, normal…

Q: Which of the following components of the cell membrane is found exclusively in the inner layer of…

A:

Q: Write TRUE if the statement is correct, FALSE if otherwise. JOOHOB OBTAROSTI 11. Food undergoes…

A: Since you have asked a question with multiple subparts, we will answer only first 3 subparts for…

Q: ITEM I MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE AGENT GRAM REACTION A B OXYGEN REQUIREMENT C D…

A: Malaria is brought on by a type of protozoan called Plasmodium falciparum. Malaria is a serious…

Q: Greg and Susan have Nail- Patella syndrome (NPS). NPS is an autosomal dominant. Greg has a blood in…

A: Introduction  The nails, knees, elbows, and pelvis are abnormal in people with nail-patella…

Q: Why/how is pyruvate oxidized after glycolysis and before it enters the citric acid cycle?

A: Pyruvate oxidation, one of the four phases of cellular respiration, stands out since it is one of…

Q: Please answer fast 3) There are very few native reptile and amphibian species in Maine. What…

A: Abiotic components are the non living components of ecosystem, which controls and determines the…

Q: Describe the cultural, social, political and economic activities of the following stages of human…

A: Evolution :

Q: Eukaryotic messenger RNA includes a poly A tail. When the poly(A) tail is less than approximately 30…

A: Introduction  Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that, in molecular…

Q: Biology The food web of the harp seal is most dependent on which of the following organisms?. 1.…

A: Food-web is defined as "the network of complex interactions among species in an ecosystem"

Q: In which of the following foods are microorganisms involved in their production? Coffee Chocolate O…

A: Microorganisms contaminate food throughout the process, from harvesting to preparation to…

Q: Calculate the matching probability (pM) and the power of discrimination (PD) for a gene with two…

A: Each gene allele has a particular frequency of occurring in a population. Matching probability and…

Q: How do molecules of atp store and provide energy for the cells ?

A: Adenosine triphosphate (ATP) is the source of energy for use and storage at the cellular level. The…

Q: 17-19. A man and women of normal phenotype have a son with Duchenne muscular dystrophy, a sex-linked…

A: The correct option is (c) A=1/2 OR 50%,B=0%,C=1/4 OR 25%

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Which of the following proteins preserves an epigenetic alteration of DNA? O MYOD O Ey O HAT…

A: Introduction  Epigenetics is the study of how changes in your environment and behaviour can have an…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Question 9 o Which of these is true about the pO2 at the end of the pulmonary capillaries in…

A: Pulmonary capillaries are the smallest blood vessels inside the lungs. It carries deoxygenated blood…

Q: what could have happened to the isolates when she re-streaked them repeatedly and recommend a…

A: Mangroves are part of the coastal ecosystems in the sub-tropical and tropical regions across the…

Q: Direction: Answer the following questions. 1. What distinguishes humans from other animals? Why? Can…

A: The humans who has a evolutionary past with their ancestors are highly civilized with several…

Q: What is the difference between A-delta and C fibers?

A: Nociceptors are made up of different kinds of nerve fibres (axons) that have free ends. The diameter…

Q: Find the number of traits expressed by each species. Find the number of species possessing each…

A: Disclaimer:  According to Bartleby guidelines only the 1st question can be answered. Please repost…

Q: Discuss the mechanistic approaches and limitations for the detection of aerosolized respiratory…

A: When an infectious agent is transmitted via air with the help of droplet nuclei which are also known…

Q: What conditions compromise host defenses against microorganisms?

A: The term "human microbiome" refers to the complex biological system of microbes that resides in and…

Q: Which of the following is most expected with polycythemia? a) Decreased blood viscosity b) Decreased…

A: Blood cancer of this kind is called polycythemia vera. The bone marrow produces an excess of red…

Q: 2. To tube 1, add 10 μl of 50:50 AT:GC DNA (tube B). 3. Add 5 μl of Buffer to tubes 2-7. 4. Remove 5…

A: The results of a polymerase chain reaction (PCR) are significantly influenced by the overall amount…

Q: Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 =…

A:

Q: The volume of ejaculate in a man during sex with a partner is related to  a The time since last…

A: Introduction The ejaculation of males is called "semen". It contains numerous sperm and out of all…

Q: How are genes transmitted from parent to offspring?

A: Introduction: The fundamental structural and operational component of heredity is a gene. DNA is the…

Q: g Toll-like receptor

A: Macrophages work as innate immune cells through phagocytosis and sterilization of foreign substances…

Q: Refer to the following illustration to answer the question. O protein A is not made because it is…

A: There are some substances (protein, carbohydrate etc) which regulates the expression of genes. For…

Q: How do macrophages, granulocytes, and lymphocytes work together to locate, recognize, and eliminate…

A: The immune system is a vast network of the body's specialised organs, cells, and tissues that play a…

Q: Completely pubescent (60 hairs/cm³)? Intermediate pubescent (30 hairs/cm)? With 40 hairs/cm²?…

A: Polygenic traits are characteristics controlled or influenced by more than two genes. The genes have…

Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…

A: Bacteria are ubiquitous microscopic prokaryotic organisms which exhibit 4 different stages of growth…

Q: Explain the similarities and differences between the green and brown food webs. How are they…

A: A green food cycle (in the outer cove) and a brown food cycle (in the inner cove). The greenland…

Q: batches of competent cells into electrocompetent cells for transformation. In the end, the competent…

A: We know that transformation is the alteration of cell by introducing foreign genetic material into…

Q: What if three genotypes have different fitness levels, so that both kinds of homozygotes are more…

A: Fitness is a quantitative measure of individual reproductive success. It is also equal to the…

Q: Photosynthesis A. is the only energy-generating pathway for plants, cyanobacteria, and algae. B.…

A: Photosynthesis is a process that plants and other organisms use to convert light energy into…

Q: Type of infection for the following and small info about them: E. Balantidiasis F. Sleeping…

A: Introduction  An infectious disease brought on by parasites is referred to as a parasitic disease,…

Q: Please explain Androgen Insensitivity Syndrome (ALS). What is the phenotype of these individuals?…

A: The common etiology of aberrant sexual development, androgen insensitivity syndrome, results in a…

Q: c. Questions 1. Which wavelengths of light are best absorbed by the chlorophyll extract? 2. Which…

A: Since there are multiple questions in this particular question, I will answer the three subparts for…

Q: A woman diagnosed with early-onset Alzheimer's due to a mutation of the APP genehas children with a…

A: Azheimer's disease (AD) is a neurodegenerative disorder characterized by progressive dementia and…

Q: The trigger for an action potential is:

A: The potential difference across a membrane is known as the Membrane Potential. Frequent, rapid…

Q: what is gor

A: GOR method was developed in the late 1970s.

Q: For the symbiotic relationship between termites and protozoa - the termite provides a favorable…

A: There are different type of relationship between microbes and others parasites or animals that can…

Q: 1.    Show the different kinds of gametes which can be formed by individuals of the following…

A: Genotype is genetic makeup of organism. So, in this question we need to determine the gametes from…

Q: O C a. b. Ú Rate of Reaction d. of Reaction Rate of Reaction Rate of Reaction 100 Temperature (C)…

A: Given are four graphs depicting the relationship between rate of reaction and temperature. The best…

Q: What is ecology?At what different levels do ecologist study ecology? Define and describe  each level…

A: Introduction  All the organisms and the environment they interact with make up an ecosystem. The…

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."