Each new double helix will contain ___________ strand of DNA from the parent strand and ____________ strand of newly created DNA.

Each new double helix will contain _ strand of DNA from the parent strand and __ strand of newly created DNA.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Related questions

Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are…

A: Topic: an essay on " Ability of DNA to assume various forms and their importance ".

Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…

A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: Using your own words and including the phrases “5' to 3" and "3' to 5" explain how a double helix of…

A: The genetic material of many species, including humans, is DNA, or deoxyribonucleic acid. The…

Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.

A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…

Q: If thymine makes up 15 percent of the bases in a specific DNA molecule, what percentage of the bases…

A: Answer- According to the chargaff's rule A/T=G/C that means the number of purines and pyrimidines…

Q: In light of your knowledge of DNA replication, discuss the following statement: "Only the DNA is…

A: Dna replicates semiconservatively is proven by matthew meselson and franklin stahl by performing an…

Q: The bacterial chromosome is a ring of____________-stranded DNA.

A: DNA is the source of genetic information that flows from generation to generation. DNA molecules are…

Q: The two strands of DNA in a double helix are ______________.

A: The DNA is the genetic material of most of the organisms. It is a a polymer of nucleotides that…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: If a molecule of DNA contains 42% thymine, then there is adenine, cytosine, and guanine.

A: DNA refers to Deoxyribonucleic acid. It is genetic material of almost all the organisms, except few…

Q: In the double helix of DNA, the ____________ bases of one strand exhibit complementary base…

A: The question asks about the helical structure of DNA in terms of complementary bases.

Q: Okazaki fragments are found on the _____________ strand.

A: DNA replication is the process by which DNA synthesise its copy prior to cell division. The two…

Q: A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing…

A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic codes for an…

Q: DNA replication described as “semiconservative

A: DNA Replication It is the process by which a double stranded DNA can form it's replica or copy.

Q: true or false: a nucleotide’s 5 end provides the energy to synthesize a new strand of DNA.

A: Replication is one of the essential properties of genetic material because the progeny cells should…

Q: Biological functions of DNA

A: INTRODUCTION DNA is required for heredity, protein-coding, and delivering instructions for life and…

Q: A single strand of DNA runs from ___________ to ___________.

A: Every DNA strand has two closures. The 5' end of the DNA has the terminal phosphate group on the 5'…

Q: If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears…

A: DNA is a deoxyribose sugar nucleic acid that carries genetic information from one generation to…

Q: If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…

A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…

Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…

A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…

Q: The two strands in DNA are not identical but complementary. Explain.

A: A DNA nucleotide is composed of five-carbon sugar called deoxyribose, a phosphate group, and one of…

Q: The DNA of identical twins is an exact match.

A: Yes DNA of identical twins is an exact match and is 100% match as they are formed from the same egg…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…

A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…

Q: DNA positively supercoils during replication and negatively supercoils in transcription.

A: Transcription is a process where DNA replicate into RNA, while replication is the making of DNA…

Q: What is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds…

A: DNA strands are essentially polymers that comprise of deoxynucleoside monophosphate that are linked…

Q: Write the sequence of the DNA strand complementary to the following strand:…

A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…

Q: double-stranded DNA is dissociated into

A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: A student was analyzing the base composition of a DNA sample, but has lost all the data except the…

A: DNA nucleotide base structure: Each individual unit of the DNA nucleotides is made up of a…

Q: complementary DNA sequence

A: Answer: Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded…

Q: If one of the strands of DNA has the following sequence of bases running in the 5-S3'…

A: The given strand is: 5'-G-G-A-C-A-A-T-C-T-G-C-3` The complementary strand for the given sequence is:…

Q: Using your own words and including the phrases “5’ to 3’” and “3’ to 5’” explain how a double helix…

A: DNA or deoxyribonucleic acid is the genetic material of many organisms including humans. The two…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…

A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…

Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…

A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…

Q: You are given the following sense DNA sequence:…

A: Solution According to chargaff rule In DNA the Pyrimidine Thymine (T) always pairs with the Purine…

Q: DNA REPLICATION/REPAIR PROTEINS PROTEIN FUNCTION

A: DNA ( Deoxyribonucleic acid) replication is a process of making two copies of DNA by replicating…

Q: We often describe the shape of DNA as a

A: DNA DNA is a genetic material which reside in the nucleus of the organisms. DNA carry information…

Q: DNA polymerase

A: For DNA to under replication it requires different proteins and enzymes. They are, DNA polymerases,…

Q: When the dna is relaxed in the cell and is all stringy and evenly spread throughout the nucleus, we…

A: The human DNA of 6.6 x 109 base pairs (bp) is compactly packed using histone proteins inside the…

Q: . The DNA strand whose %T is 50%

A: DNA Deoxyribonucleic Acid (DNA) is the genetic material of many organisms including viruses,…

Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…

A: DNA is the genetic material that involves the transfer of information from one generation to the…

Q: What was the first, DNA or RNA? Justify your answer with solid reason

A: The DNA replicates itself from the template itself using the DNA polymerase. The RNA is transcribed…

Q: If a double stranded DNA molecule is 20% thymine, what are the percentages of all other bases? 1.…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Each new double helix will contain ___________ strand of DNA from the parent strand and ____________ strand of newly created DNA.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?
the following is a strand of a DNA
The DNA base C always pairs with ___
A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing nucleotides. How many pyrimidine bases does this DNA segment possess?
In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
Single-stranded regions of DNA are attacked by nucleases in the cell, yet portions of DNA are in a singlestranded form during the replication process. Explain.
– Draw a DNA strand with 10 adenine bases followed by 10 cytosine bases. If that same strand bonded to a strand of 15 thymine bases and 5 guanine bases, how would the double helix shape vary from a typical DNA double helix? Explain why. Must draw picture of both strands that helps to illustrate your written answer – no credit for one without the other.
A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
The rungs in the middle of the twisted ladder of a DNA are called