Answered: Elongation factor __________…

Name: 28Elongation factor __________ reactivates arrested RNA polymerase II.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 28Elongation factor __________ reactivates arrested RNA polymerase II.A.TFIIEb.TFIISc.TFIIFD.TFIID29Eukaryotic translation initiation proceeds through a ( ) mechanism. 30A variety of transcription ______________ factors helps to suppress transient p

Science

Biology

Elongation factor __________ reactivates arrested RNA polymerase II

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 8TYU: Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription...

See similar textbooks

Similar questions

The transcription initiation factor “recruited” together with RNA-Pol II in the formation of preinitiation complex is A. TFIIB B. TFIIH C. TFIIF D. TFIIA
The “domain-swapping” experiment that grafts the Gal4 DNA-binding domain to the LexA activation domain generates a chimeric protein that will: A) bind to the Gal4 site. B) bindto the LexA site. C) activate transcription of the LexA gene. D) activate transcription of alleukaryotic genes. E) All of the answer options are correct.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely? a. transcription levels will increase as the GC content would increase b. this mutation is silent, so no change in transcription level c. transcription levels would decrease because the promoter would be weaker d. transcription levels do not depend on the promoter sequence for the gal gene e. nothing would happen because the promoter would not change the mRNA sequence
Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT
Histone deacetylase (HDAC) enzymes a.Promote initiation of translation. b.Complex with hyperphosphorylated pRb. c.Repress E2F family activity. d.Add acetyl groups to E2F promoters. e.Promote initiation of transcription.
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To make the Hex A protein: The promoter and transcription termination sites are 33,000 base pairs apart. The Hex A protein has 600 amino acids 5’ and 3’ UTR’s are each 500 bp long. a)How many base pairs would you expect in the final mRNA? Show your work b)How many bases were spliced out? Show your work
A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers provided
With regard to transcriptional termination in eukaryotes, which model(s) suggest(s) that RNA polymerase is physically removed from the DNA by an exonuclease?a. Allosteric modelb. Torpedo modelc. Both modelsd. Neither model