Exon duplication of multiple alpha-helix coding domains is thought to be responsible for the origin of which vertebrate gene (coding for what is now the most abundant protein in human blood)? the plasminogen gene the albumin gene the urokinase gene the opsin gene the collagen gene

Exon duplication of multiple alpha-helix coding domains is thought to be responsible for the origin of which vertebrate gene (coding for what is now the most abundant protein in human blood)? the plasminogen gene the albumin gene the urokinase gene the opsin gene the collagen gene

Name: Exon duplication of multiple alpha-helix coding domains is thought to
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Exon duplication of multiple alpha-helix coding domains is thought to be responsible for the origin of which vertebrate gene (coding for what is now the most abundant protein in human blood)? the plasminogen genethe albumin genethe urokinase genethe

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 17TYU

See similar textbooks

Similar questions

. Exon duplication of multiple repeating subunits is thought to be responsible for the origin of which vertebrate gene (coding for what is now the most abundant protein in the human body)? the urokinase gene the plasminogen gene the albumin gene the collagen gene the opsin gene
Which of the following protein-coding genes in the human genome would be the least likely tocontain non-coding intervening sequences (introns)?A. the gene for -globinB. the gene for -globinC. the gene for -globinD. the gene for histone H3E. all of the above genes would be equally unlikely to contain any introns
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
The human proteome contains a much greater variety of proteins than would be predicted from the human genome. What molecular phenomenon best explains this diversity?
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotife sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
In the presence of cephalosphorin, what will be the protein product of the prokaryotic cell gene shown below? 5'-CATGTCAGTAAGGCATCT-3' (Assume this is a segment of a larger structural gene that will be translated into protein in its entirety.)
Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired gene
An interesting phenomenon found in vertebrate DNAis the existence of pseudogenes, nonfunctional copiesof a gene found elsewhere in the genome. Some pseudogenes appear to have originated as double-strandedDNA copies of mature mRNA inserted into the chromosome; these copies later underwent mutations tomake them into pseudogenes.a. What sequence information might provide cluesthat the original source of some of these pseudogenes is cDNA copied in cells from mRNA andthen inserted into the genome?b. Would this mechanism of generating pseudogenesbe more likely to have operated if the pseudogenewas part of a gene family clustered in one region ofthe genome, or if it was instead part of a genefamily whose members are scattered around thegenome? Explain
It has been suggested that the present-day triplet genetic codeevolved from a doublet code when there were fewer amino acidsavailable for primitive protein synthesis. As determined by comparisons of ancient and recently evolved proteins, cysteine, tyrosine, and phenylalanine appear to be latearriving amino acids. In addition, they are considered to have been absent in the abiotic Earth. All three of these amino acids have only two codons each, while many others, earlier in origin, have more. Is this mere coincidence, or might there be some underlying explanation?
Which cytosines could be methylated in a typical mammalian genome? Why? 5’-GCCGCGC-3’