The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 12 в в 11 E2 E4 Exon (E) Intron (1)

The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 12 в в 11 E2 E4 Exon (E) Intron (1)

Name: The figure below shows the introns and exons found in gene X. The siz
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on thisorganism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
a) Two of the following three mRNA sequences code for the same protein. Delete the sequence which does NOT code for the same protein as the other two. [ /1] #1 UUU CCU AGU GGU #2 UUC CCA AGC GGC #3 UUC CCG AGA GGA b) Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two. Based on what you have learned in this unit, explain how this might happen.
Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.) Using the mRNA sequence completed, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart provided
The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affected
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?