Select the chemical consequences that could contribute to DNA instability at AP sites.fewer hydrogen bonds between the unpaired pyrimidine base and waterdisruption of the base-stacking interactionsincreased ability of the deoxyribose ring to open without the attachment of the purine basedecreased interaction between the mutated DNA strand and histones Hydrolysis of the N-glycosyl bond between deoxyribose and apurine base in DNA creates an apurinic (AP) site. An AP site ismore thermodynamically destabilizing to a DNA moleculethan is a mismatched base pair.Examine the structure of an AP site.HNH₂N N0Guanine-O-P-O-CH₂O.H₂NHHNHH HHodHofo-0-Guanosine residue(in DNA)-0-CH₂HH HApurinic residueHOHH

AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…

Select the chemical consequences that could contribute to DNA instability at AP sites. fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions increased ability of the deoxyribose ring to open without the attachment of the purine base decreased interaction between the mutated DNA strand and histones

Select the chemical consequences that could contribute to DNA instability at AP sites. fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions increased ability of the deoxyribose ring to open without the attachment of the purine base decreased interaction between the mutated DNA strand and histones

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

RNA is ribonucleic acid, and DNA is deoxyribonucleic acid. What exactly is deoxygenated about DNA?
List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′
The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?
The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a solution containing the three DNA molecules below, in what order do you think these DNAs will "melt"? Explain 1)5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ 2) 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’ 3) 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of three possible) with G or C?
Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely unwound – would have the highest relative absorbance at 260 nm. Would a molecule of DNA having a higher content of guanine and cytosine than of adenine and thymine have a higher or lower melting temperature (Tm) than one with the reverse composition?
In a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
The backbone of the DNA molecule is made up of two alternating componebts, what are these? Explain.
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?