Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: 3' TAC TCC GGC TCT CCC AGT TGA ACT 5' The sequence given is 3' to 5' sequence. Let us transcribe it…
Q: et’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient…
A: Sickle cell disease causes often term that they are usually state as chronic hemolytic anaemia,…
Q: Does crude mRNA have density? if so what is the density value ? Thank You
A: Introduction mRNA is single stranded RNA. Which carries genetic information from DNA to ribosomes…
Q: 1) Once the JJ vaccine enters the human cells, what must happen in order for a spike protein to be…
A: Vaccines are basically inactivated or weakened portions of a pathogen that are introduced into the…
Q: Using the Concord Consortium interactive, observe how mutations can affect protein formation and…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…
Q: - Fraumeni Syndrome (LFS) is a rare hereditary cancer disease due to a mutation in the TP53 gene.…
A: P53 is a transcription factor and is a tumor suppressor protein synthesized by tp53 gene. P53…
Q: Choose the correct option for following three mcqs 13.Which of the following statements about tRNA…
A: Aminoacyl-tRNA synthetase , is an enzyme that attaches the appropriate amino acid onto its…
Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…
A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…
Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…
A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…
Q: Detail of basic steps involved in synthesis of a recombinant drug product. Justify by manufacturing…
A: The basic steps involved in the synthesis of a recombinant drug product are as follows: - Isolation…
Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…
A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…
Q: Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate…
A: Enzymes are basically proteins that are intricately packed inside with the help of intramolecular…
Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…
A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…
Q: What is the importance of using multiple purification methods in isolating a protein?
A: Introduction Proteins are substantial biomolecules and macromolecules made up of one or more…
Q: Please select appropriate word in each bracket Many anti-cancer drugs affect nucleotide metabolism…
A: Nucleic acid metabolism refers to the set of reactions that are responsible for synthesis and…
Q: I Heat shock response in E. coli - What kinds of gene products are made during the response and why?…
A: The heat shock response in E. coli resulted in the production of over 20 heat shock proteins, which…
Q: _____ Mutants Are Useful in ______ the Order in Which Proteins Function.
A: Saccharomyces cerevisiaes, or baker’s yeasts, unicellular fungi are useful in understanding genetics…
Q: Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA…
A: Introduction: Enzymes are the catalysts that increase the rate of the reaction that occurs inside…
Q: evasion? Because the spike protein is the target of COVID-19 vaccines. Because mutations in the…
A: A mutation is a change that occurs in our DNA sequence.Mutations arise spontaneously at low…
Q: In humans, sickle-cell anemia and hemophilia represent which type of mutations? Loss of…
A: Mutations are of different types. Mutations are change in the sequence of DNA which may cause the…
Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?
A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…
Q: State whether the gene is up- or down-regulated and briefly explain the reason behind. The…
A: A polypeptide is composed of twenty standard amino acids. These twenty standard amino acids are…
Q: 30) In the CRISPR system, the targeted DNA sequence is
A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…
Q: "The polarity of the mRNA molecule, which is synthesized during translation, runs from 5' - 3'…
A: Cell is the basic unit of all living tissue. In humans, there is a structure called the nucleus .…
Q: EF-Tu: EF-Ts as ORF-1:RF2 eEF1A:eEF1B O Shine-Dalgarno:5'-7mG O Co-translation: post-translational…
A:
Q: Matching. Select the mode of action for each drug in the left column; all but one choice is used. –…
A: Antimicrobial drugs have various modes of action, most of them being inhibitory in nature. They…
Q: A lot of time and energy put into creating tRNAs; why?
A: A transfer RNA is a kind of RNA molecule that helps to match an mRNA codon with the amino acid it…
Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…
A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'
Q: 21. mRNA serves as template for the synthesis of polypeptide. true or false
A: The translation process is by which organisms forms protein or a polypeptide chain.
Q: Choose the correct option for following three mcqs 7.The first step in the capping reaction is…
A: Introduction: The correct choice is "phosphatase". The correct choice is "RNA polymerase-II". The…
Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…
A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…
Q: uconcogenesls
A: Glycolysis is a Greek word which means sweet and lysis or the lysis of sweet. the other name of the…
Q: 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely…
A: Introduction RNA Interference (RNAi) Is A Biological Mechanism In Which Double-stranded RNA…
Q: Site-directed mutagenesis of enzyme active site explained
A: Oligonucleotides are generally either DNA or RNA. The length of these is 15-30 nucleotides. The use…
Q: Would love a list of different types of nucleotide repeat disorders.
A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…
Q: Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020…
A: To fill the table
Q: Please ASAP. Thank you A nociceptor-specific knock-out mutation of Nav1.3 in mice resulted in…
A: In a knockout gene the permanent function of the gene is lost by manipulating its DNA. It is also…
Q: Updates Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal…
A: Sickle cell anaemia is a genetic disease caused by an abnormal haemoglobin. The resulting change in…
Q: Explain briefly how bacteriophages causes mutation .
A: Bacteriophages (phages) are the most numerous organisms on the planet, yet very little learned…
Q: A. How can DNA be used to pass on inheritable material & make proteins?
A: DNA or deoxyribonucleic acid is our genetic materials that is present in the nucleus of the cell. It…
Q: Describe missense and nonsense mutations and how they are different from frameshift mutations.
A: Mutations can be defined as changes in the DNA sequence. It can result from errors in replication or…
Q: Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
A: Sickle cell anemia is the result of a point mutation in the hemoglobin gene. Sickle cell hemoglobin…
Q: Briefly explain the significance of telomerase in normal cells versus tumors and cancer cells
A: In promulgating progenitor cells deduced from labile normal stem cells as well as in embryonic stem…
Q: Explain how these mechanisms affect protein diversity.
A: Post-translational Modification (PTM) generally refers to the large enzymatic adjustment of proteins…
Q: Hi, can you please explain the clinical significance of G protein mutations.
A: Introduction:- G proteins control transcription, motility, contractility, and secretion, which in…
Q: Complementation and mapping analyse of Lac− mutants
A: Introduction: The lactose operon is a type of operon that is needed to transport and metabolize…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Please help and make it short. Also, please don't use advanced words when explaining, thanks!
Explain how the mRNA vaccine work and relate to protein synthesis (Moderna and Pfizer vaccines are both using this technology).
Step by step
Solved in 2 steps
- Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequenceCHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Binds to bacterial DNA gyrase & topoisomeraseGood afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
- Need help, please. Drop-down answer choices for question 1: DNA polymerase, flippase, RNA polymerase, or protease. For question 2, you type the answer in.What is the method of MS protein quantification presented here? Please answer very soon will give rating surely Complete Answer neededPlease help me answer topic is about making a recombinant DNA model
- (Please answer all parts, thank you!) -The Johnson and Johnson vaccine contains the DNA that codes the spike protein. Moderna and Pfizer vaccines contain the mRNA that codes the spike protein. 1) Once the JJ vaccine enters the human cells, what must happen in order for a spike protein to be made? a) DNA replication only b) DNA replication, transcription and translation c) Transcription and translation d) Translation only 2) Once the Moderna or Pfizer vaccine enters the human cells, what must happen in order for a spike protein to be made? a) DNA replication only b) DNA replication, transcription and translation c) Transcription and translation d) Translation only ___________________________________________________________________________________________ 3) The Pfizer and Moderna vaccines contain the mRNA instructions for making the spike protein. After injection, the cells of the body make a) The spike protein b) The full COVID19 virus with the spike proteinMRNA- based therapeutics The following questions: Which research group has initially developed the technology? What was the purpose behind the invention of the technology? What type of questions could be answered with the technology? What are the applications of the technology? Are there any clinical trials associated with the method? What is the mechanism of action for the technology?Detail the differences between base excision repair and nucleotide excision repair. Please help explain in 5 sentences or less, thank you!
- Restriction mapping of the delta chromosome I need help with question two pleasePlease explain it simply, and don't over-explain. Thanks! A. How can DNA be used to pass on inheritable material & make proteins?Please select appropriate word in each bracket Many anti-cancer drugs affect nucleotide metabolism and inhibit DNA synthesis. For example, a widely used anti-cancer agent, 5-fluorouracil, is a pyrimidine analog that is incorporated into nucleotide form and affects DNA synthesis by inhibiting the activity of [ Select ] ["thymidine kinase", "ribunucleotide reductase"] , the enzyme required to synthesize [ Select ] ["dTMP", "dUMP"] . This inhibition of DNA replication affects both cancer and normal cells, and hence there are serious side effects of these agents including [ Select ] ["immune system suppression", "hyperallergenic reaction"] and damage to the [ Select ] ["lining of the GI tract", "connective tissue of cartilage"] . Methotrexate, was the first drug to actually cure a cancer, choriocarcinoma, in 1958, and serves to block the activity of [ Select ] ["dihydrofolate reductase", "serine hydroxymethyl-transferase"] , another enzyme required for the synthesis of dTMP.