uconcogenesls
Q: A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translation process…
A: Codon is a sequence of three nucleotides present in DNA or mRNA (messenger RNA) molecule that…
Q: Is it true that coconut oils contain no cholesterol? Provide reasons
A: Coconut oil is basically a tropical oil derived from the dried nuts of coconut palm tree.
Q: 30. assicuatuib if 2alpha and 2 beta chains to form adult hemoglobin
A: HbA2 is a gene that in encodes for the alpha globin chain of haemoglobin in humans.
Q: a. Transketolases catalyze two-carbon fragment transfer from sedoheptulose-7-phosphate to…
A: "Since you have posted multiple questions we will answer the first question for question. If you…
Q: In the indicated tissues, how will each process or the activity of each enzyme below be affected by…
A: Glucagon is a hormone secreted by the alpha cells in pancreas. It is a principle hormone regulates…
Q: explanations are not needed. Direct answers would suffice. a. Which of the following conditions…
A: The breakdown of glycogen ,to generate glucose is a process termed as glycogenolysis , it occures in…
Q: The TATA box and Initiator element (Inr) is recognized by which protein complex? How tight is this…
A: The sequence TATA can be found in most promoters. This sequence binds RNA polymerase. The TATA box…
Q: na ligation and sticky-ehd produced from blunt-end iigation and sticky-end ligation (Hint: observe…
A: Biotechnology is a branch of science in which the life processes has been indulged with technology…
Q: What are the respective associated substances & processes? reduction regeneration RuBP RUBISCO NADPH…
A: Photosynthesis occurs in basically two steps and they are light reaction and dark reaction. In the…
Q: Which amino acid sequence is likely to be found on the exterior of a soluble protein?
A: Proteins are polymers of amino acids linked by amide/peptide bonds. Amino acids are consist of amine…
Q: Describe in detail the four levels of protein structure
A: Folding of protein is necessary for its biological activity. Protein folding occurs spontaneously,…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Answer choices : 0.3% gel OR 1.0% gel Explanation Choices : Agarose makes smaller pore sizes which…
A: agarose gel electrophoresis is widely used to resolve DNA fragments. DNA fragments migrate accorsing…
Q: How many ATP or NADH molecules are produced or required in each of the following steps in…
A: Introduction: The pathway is also known as the Embden-Meyerhof pathway and every cell carries the…
Q: Calculate AGo' for the reaction NADH + pyruvate → NAD+ + lactate You are given: Faradays constant F…
A: Electrons from NADH and a proton are used to reduce pyruvate into lactate in lactic acid…
Q: What is the effect on OCR and ECAR of adding DNP to the cell culture?
A: Cell culture is defined as the process by which there is the removal of cells from plants as well as…
Q: the Km of an enzyme for its substrate tends to be close to the physiological (cellular)…
A: Enzymes are the biological catalyst which to increase the rate of reaction. Km is also called as the…
Q: Problem 1 Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod…
A: The Monod equation for cell growth kinetics is given below; μ = μmax [S]Ks + [S] here 'μ' is…
Q: how is peptide molecules similar to biuret molecules
A: Introduction: Peptides are short polymers of amino acids that are connected by peptide bonds. It is…
Q: Materials that allow flow of water are_______
A: Running fluid moves innately in a gravity-driven direction all along slope and finds its own way.…
Q: Which vitamin can be produced by the body? O A OD O E
A: Vitamins are not synthesized in the body. Some bacteria in the gut can produce some of the vitamins…
Q: If glycogen is depleted in the liver, which of the following is also occurring? Group of answer…
A: This phenomenon is stated as "hitting the wall". Glycogen depletion may be forestalled in 3 viable…
Q: Briefly explain how ester hydrolysis experiments helped to provide evidence for the mechanism of…
A: Carboxylic acid and free alcohol are formed by an ester hydrolysis reaction that breaks an ester…
Q: Please explain how glycolysis is linked to the CAC.
A: CAC : Citric acid cycle Pyruvate : Glycolysis end product Glycolysis, the CAC are linked via the…
Q: Describe the whole process and the principle behind DNA extraction.
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: efly
A: There are various methods of studying the Enzyme-substrate complex like magnetic resonance…
Q: What are the fundamental differences between a good solvent and a theta solvent, and how do they…
A: There are different types of solvents that are present between the segment of polymers and the…
Q: Draw amylose and cellulose. Explain the differences Can we digest both molecules? Why or Why not?
A: Both Amylose and Cellulose are polysaccharides containing glucose residues.
Q: How does the DNA hold information?
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Calculate the concentration of a-ketoglutarate if the concentration of isocitrate is 18.9 mM and the…
A: Lets assume that all the given concentrations are equilibrium concentrations and we are expected to…
Q: Which of the following is the complementary strand of a DNA strand made up of 32% cytosine? A.…
A: Two strands of DNA are complementary to each other , if we know the sequence of one strand, we could…
Q: Neutrophils exhibit a respiratory burst of free radicals and strong oxidizers during acute…
A: Free radicals are highly energetic chemical species that go onto react with almost anything.…
Q: Phosphoglycerides are composed of: (select all that apply) Group of answer choices sphingosine…
A: Lipids are classified as simple lipids, compound lipids, and derived lipids. Simple lipids are the…
Q: What modifications can be done to streptomycin's structure to enhance its pharmacokinetics and…
A: Streptomycin is the primary found aminoglycoside antibiotic, initially isolated from the micro…
Q: Which is a characteristic of cooperative binding that is exhibite by a protein? O Momomeric…
A: Introduction: A macromolecule will show cooperative binding if its affinity for its ligand changes…
Q: Alterations in our genome can lead to a variety of genetic diseases including cancers. These can be…
A: Genetic diseases occurs when some harmful variation occurs in the genetic makeup or genes of any…
Q: Trypsin and pepsin are both important proteases but they differ markedly with respect to: O aqueous…
A: "Since you have posted multiple questions we will answer the first question for you. If you want…
Q: The following plasmid is digested with EcoR1 and Ndel restriction endonucleases. Agarose…
A: Restriction endonucleases are enzymes which cleave the phosphodiester bonds within a DNA. These…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Sickle cell anemia is a inherited disorders due to defect in the gene. In this disease mutation…
Q: - Multiple Choice - Explain your answer in 3-5 sentences. - answer properly QUESTION: Which of the…
A: Isocitrate dehydrogenase is a regulatory enzyme of the Krebs cycle. Isocitrate dehydrogenase…
Q: Using the Pearson square technique, determine the amount (lb) of skim milk (assume 0.0% milkfat)…
A: Skimmed milk contains no cream or less fat than regular milk. Typically, it contains just 0.1% fat…
Q: Which stereoisomer of the monosaccharide threose is shown below? a. D b. L c. R d. S
A:
Q: Long explanations are not needed. True or False a. One NADH is produced for every pyruvate…
A: The pentose phosphate pathway is an alternative pathway for glucose oxidation. It provides NADPH for…
Q: Which of the following shorthand names best characterizes the following disaccharide? a. Glc…
A: Carbohydrates are macronutrients and significant nutritional components. They can be formed as…
Q: Compare and contrast proteoglycans, glycoproteins, and glycosaminoglycans. Cite examples for each
A: Glycobiology means the study of the structure, and function of carbohydrates attached to…
Q: The reason for the decrease in the rate of enzyme reaction as the temperature is increased beyond…
A: An enzyme is a substance which serves as a catalyst in living things, governing the rate of chemical…
Q: Which of the following was used to extract DNA from the food products for the GMO lab? Ethanol…
A: DNA extraction is a technique to separate DNA from the given cell sample. It involves the steps…
Q: The synthesis of phosphocreatine is unfavorable. If dur- ing extended periods of rest, e.g.,…
A: Phosphocreatine (PCr) - It is a phosphorylated creatine molecule that works as transferable reserve…
Q: Clinical significance of Hypouremia to BUN or urea
A: Hypo uremia - Uremia is s buildup of urea/toxins in our blood. then, Hypouremia is decrease in the…
Q: Each of the following enzymes are similar in that they are all regulation points for the…
A: Enzymes are chemical substances that function in several biochemical reactions and help in the…
Step by step
Solved in 3 steps
- Calculations based on the volume of a glucose residue and the branchingpattern of cellular glycogen indicate that a glycogen molecule could have up to 28 branching tiers before becoming impossibly dense. What are the advantages of such a molecule and why is it not found in vivo?Both prokaryotic and eukaryotic organisms carry out some form of glycolysis. How does ha fact support or not support the assertion that glycolysis is one of the oldest metabolic pathways?A glucose-fed yeast cell is moved from an aerobic environment to an anaerobic one. For the cell to continue to generate ATP at the same rate, approximately how much glucose must it consume in the anaerobic environment compared with the aerobic environment?
- Describe in general terms the structural makeup of a mitochondrion.How are the mitochondrion and the hydrogenosomesimilar structurally? How do they differ? How do theydiffer metabolically?How many ATP will be produced in an oxidative level phosphorylation of a molecule of glucose in a eukaryotic cell?
- Why does the Krebs cycle operate only under aerobic conditionseven though it does not use molecular oxygen in any of its reactions?mitochondrion function in plants and animalsCells can generate as many as 36 to 38 molecules of adenosine triphosphate (ATP) from the metabolism of one molecule of glucose. Which cellular process results in this amount of ATP production?
- Consider ten glucose molecules that enter a cell. How many ATP can be generated by the complete catabolism of these into CO2 and H2O? If all ten are first incorporated into glycogen, liberated from glycogen, and then fully catabolized into CO2 and H2O, does the ATP tally increase, decrease or stay the same? Consider that 1 UTP = 1 ATP. Explain. Describe the processes which produce ATP and provide a balanced equation of glucose, CO2, H2O and O2List down the specific functions of the component structures of mitochondrion relative to cellular respiration.When a vertebrate dies, its muscles stiffen as they are deprived of ATP, a state called rigor mortis. Using your knowledge of the catalytic cycle ofmyosin in muscle contraction, explain the molecular basis of the rigor state.