Explain in as much detail as you can:

Q: Please state the step-by-step procedure of SMEAR PREPARATION? (please explain it thoroughly in a…

A: The preparation of a smear is required for various lab procedures, including the Gram-stain. The…

Q: Solve indigital format Cyanide is known to be an inhibitor of the electron transport chain in…

A: After Cyanine poisoning, electron transport chain cannot pupm electron into intermembrane space.…

Q: Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod Equation Table…

A: I gave you the answers below. Thank you.

Q: After fertilization the integument(s) of gymnosperms and angiosperms becomets O nutritive tissue O…

A: The integuments are the ovule's outer layer(s), which mature into a seed coat as the ovule matures…

Q: In his discussion of ethics and the environment, Velasquez concludes that Select one or more than…

A: Manuel Velasquez is a business ethics professor who also teaches about the societal, legal, and…

Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: (A) MRE (в) GC Box c) GRE D…

A: Introduction Metallothionein is a protein that has a high affinity toward binding heavy metal ions,…

Q: 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently…

A: As already mentioned in the question pernicious anemia is a disease which occurs due to inability of…

Q: Across plant thr Shawnee believe caused milk sickness

A: Introduction Tremetone is a chemical compound found in tremetol, a toxin combination derived from…

Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…

A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…

Q: SARS-CoV-2 was shown to be transmissible even when the carrier has no symptoms. How did this…

A: SARS virus is a positive strand RNA virus and belongs to coronavirus family.

Q: Give economic and ecological significance of Wheat species (Triticum).

A: Introduction Wheat is a grass that is commonly farmed for its seed, a cereal grain that is a staple…

Q: Some types of hormones regulate appetite. Which the hormones trigger the feeling of hunger and which…

A: The hormone which majorly triggers the feeling of hunger is Ghrelin. It is also known as the “hunger…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine.  GGA codes for Glycine.  Since the protein being coded for is completely…

Q: What is composite materials? Describe biomass derived composite materials by picking one biomass.

A: INTRODUCTION Biomass refers to the mass of living beings such as plants, animals, and microbes, as…

Q: Compare and contrast the adaptive structures of the insect ectoparasites and the endoparasites.…

A: Ectoparasites are organisms that live just on skin of humans and other animals and are classified as…

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: Compare and contrast the following minerals. As if you are in an actual class and you are to ask to…

A: To compare and contrast: To compare and contrast the minerals such as Chlorite Vs. Epidote vs.…

Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…

A: Molecular biology is the study of biological processes at molecular level. It includes various…

Q: What is corpus luteum. How does it function as an endocrine gland?.

A: The female reproductive apparatus retains an egg, and the sperm is discharged into the female body…

Q: The walls of vessels have rather significant morphological differences in the structure of the…

A: The three major types of blood vessels are arteries, veins and capillaries. Arteries carry…

Q: To completely unfold a globular protein, use both A denaturant and reducing agent b smooth…

A: Spherical ("globe-like") proteins, also known as globular proteins or spheroproteins, are one of the…

Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…

A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…

Q: In a population of 10,000 individuals, where 3600 are MM, 1600 are Mm, and 4800 are mm, what are the…

A: Allelic frequency means the rate of expression of a particular allele at a particular location in a…

Q: Punctuated Equilibrium is a hypothesis that ... O suggests that evolution is not gradual but occurs…

A: Punctuated equilibrium is a hypothesis that evolution of a species is marked by sudden isolated…

Q: 5. What causes allele frequencies to differ between biological populations?

A: Allele frequency refers to the how common and Allele is present in a population  It is determined by…

Q: produce a diagram of the replication of a viral genome of stranded RNA simple [+] and mRNA…

A: According to the answering guidelines, I'm going answer 1st three parts of the question. Please post…

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: Which of the following mutations in the Gas subunit of the GPCR pathway for glycogen breakdown in…

A: GPCRs are a large family of cell surface receptors that respond to a variety of external signals.…

Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…

A: Definition of Synapse: The specialized junction at which a neuron communicates with a target cell…

Q: a week 301. How many calories will a 150-pound person burn if he/she walks 2 mph for 1 hour? (а) 240…

A: There are many ways to assess one's activities and give them numerical values for comparison from…

Q: is a normal cellular gene that through a A an oncogene. OA) proto-oncogene...loss-of-function OB)…

A: An oncogene is a cancer-causing gene that has been mutated. A proto-oncogene is a type of oncogene…

Q: A heart microslide demonstrates cells in the shape of pale chords, wh have few myofibrilla, glycogen…

A: The heart is a muscular organ that is essential for pumping blood and supplying nutrients, and…

Q: Based on your understanding on the basic structure of fungi especially on the fungal cell membrane.…

A: Fungi  Fungi are the uni to multicellular organisms and are non photosynthetic in nature.

Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…

A: Homeostasis is defined as the state of maintaining body balance among all the body systems that is…

Q: what type of selection is this trait likely experiencing in this population?

A:

Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 100 to 10-7…

A: Original titer of Phage lysate = 3.7 * 104 cfu/mL A 100 dilution essentially means that the sample…

Q: Complex III delivers 4 protons. Where do these 4 come from UQH2 mitochondrial intermembrane space…

A: Introduction :- The electron transport chain's Complex III, also known as Q-cytochrome c…

Q: You are working with a bacterial lysogen and have decided to induce lysis. What needs to happen for…

A: Viruses are an obligate intracellular parasites. Some viruses are temperate phages that have to…

Q: Binding of epithelial growth factor (EGF) to its receptors will result in Ras A) shutting down cell…

A: .A gene that controls cell proliferation and can function as a transcription factor, growth factor,…

Q: A. Complete the table below by filling in the information you have learned from the concept on the…

A: There are two primary processes associated with the gene expression. Gene expression refers to the…

Q: UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G…

A: Genetic Code The genetic code is the relationship between the sequence of basis in DNA or its mRNA…

Q: How do climate change and extreme weather conditions (i.e. typhoons) affect the water management…

A: Introduction Climate change is already affecting life in Asia. as an example, rising temperatures…

Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).

A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…

Q: What are some general similarities in how receptive fields are represented by the nervous system?…

A: Receptive field is a region in the sensory periphery within which stimuli can influence the…

Q: , differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase…

A: It is an enzyme which is produced by salivary glands and it have seen hydrolysis and digestion of…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Cellular respiration, like burning, results in the complete oxidation of glucose into CO2 and water.…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…

Q: 1. The physical factor influencing water entry into and exit from cell interior resulting in…

A: Introduction A pathogenic bacterium, or microbial cell, is a living entity that is too small to see…