Q: Define gene knockout.
A: A gene is the basic and functional unit of heredity and can be defined as a functional part of DNA…
Q: Explain one experimental strategy for determining the functional role of the mouse HoxD-3 gene.
A: HoxD-3 gene basically functions in the process of morphogenesis and belongs to the category of…
Q: What phenotype is expressed from the genetic trait hemophilia?
A: The genetic trait hemophilia is an inheritable trait that exhibits the X-linked recessive…
Q: describe what is CNVCopy number variant?
A: The human genome consists of 6 billion chemical bases or nucleotides of DNA packed into two sets of…
Q: Illustrate and give the normal sequence and the mutated sequence in Leigh's syndrome
A: A disease is a state of unhealthiness of the physical body, mind and social interaction. A disease…
Q: Describe the most common molecular mechanism for recessively inherited human genetic diseases such…
A: Cystic fibrosis is an inherited life threatening disorder which damages lungs and digestive system.…
Q: Explain the mechanism action of denaturation of protein from egg (Albumin) using isopropyl alcohol.
A: Denaturation involves the breaking of chemical bonds that support the protein in its highly ordered…
Q: Explain about the pleiotropic gene.
A: A gene is a stretch of nucleotides present in the DNA. It codes for the synthesis of an RNA or…
Q: Explain why mutations occur in the CFTR?
A: The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane…
Q: explain the symptoms of Robertsonian translocation?
A: Robertsonian translocation is a type of translocational chromosomal aberration in which acrocentric…
Q: To examine: Whether the given statement, "each member of the human hemoglobin gene family, which…
A: Many double-stranded linear is generally defined that they are the DNA molecules that make up the…
Q: Name the type of translocations and explain their mechanism of occurrence.
A: Translocations were discovered for the first time in the late nineteenth and early twentieth century…
Q: explain RNA editing of mitochondrial gene transcripts
A: Transcription is the first step in gene expression during which the nucleotide sequence of DNA is…
Q: What genes maintain the pluripotency of PGCs before migration? What will promote their conversion…
A: PGCs or primordial germ cells are the precursors of gametes and are the first lineage of cells,…
Q: Define Structural models of human CDK2.
A: Enzymes are biological catalysts that help in catalyzing or speeding up biological reactions by…
Q: Describe the function of CYP3A4?
A: Answer- CYP3A4 or cytochrome P450 3A4 is a human enzyme that is present and synthesized in the…
Q: Explain the Comparison of the regions of human NF1 protein and S. cerevisiae Ira protein that shows…
A: Huge amounts of sequences of DNA have already been determined. The pace at which fresh sequences are…
Q: Among different species, describe three distinct mechanisms foraccomplishing dosage compensation.
A: Dosage compensation is a mechanism by which organisms equalize the gene expression between different…
Q: What are the possible genotypes of the PTC locus?
A: * genotype means collection of genes that refers to two alleles of a particular gene and genotype…
Q: Describe what are missense mutations and its effects on structure and function using haemoglobin as…
A: A missense mutation may be a mistake within the DNA which ends up within the wrong aminoalkanoic…
Q: Explain The eyeless/Pax-6/AN gene is crucial for eye development?
A: The eyes are the visual organs of the body. They absorb light and change it into electro-chemical…
Q: Explain the mechanism and types of the cleavage.
A: Cleavage in developmental biology refers to the cell division occurring in the early stages of the…
Q: Briefly describe how the cyclin D-cdk4/6 and cyclin E-cdk2 complexes regulate Retinoblastoma protein…
A: Retinoblastoma is the disease occurring in the retina of the eyes. This is basically eye cancer…
Q: Explain the construction of knockout mice?
A: Knocking out the action of a gene gives significant insights about what that gene ordinarily does.…
Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…
A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…
Q: Use curve arrows to show the mechanism for the proposed conversion of 2a, 2b, 2c, and 2d to 4.
A:
Q: Which of the following is an accurate model and description of anaphase IIII in Cape parrots?
A: Answer :- As per the Karyotype of the somatic cells from the cape parrots obtained, they have total…
Q: Explain the following term: Gene:
A: Genes are found on chromosomes, which are small spaghetti-like structures.
Q: Define the product of the MT2A gene ?
A: Chromosome is a genetic material made up of two DNA strands. DNA is a polynucleotide that stores…
Q: Describe the functions of the RAG1 and RAG2 and NHEJ proteins.
A: Deoxyribonucleic acid (DNA) is a long molecule. DNA contains the instructions an organism required…
Q: Besides CFTR, what othe gene is associated with cystic fibrosis?
A: Introduction Cystic fibrosis:- It is an inherited disorder that causes severe damage to the…
Q: Match the following protein pair with whther they are orthologues, paralogues or neither.…
A: Homologous genes are those gene that share a common evolutionary ancestor. A pair of homologous…
Q: Explain the action of the mitochondrial uncoupling protein
A: An uncoupling protein (UCP) is a protein present in inner mitochondrial membrane.
Q: This asymptomatic disorder, typically discovered accidentally, is caused by mutations in the SLC36A2…
A: Both the mutations are associated with Iminoglycinuria
Q: How many copies of mitochondrial 16S rRNA gene are integrated in Human chromosomal DNA ?
A: NCBI BLAST is an alignment bioinformatic tool that helps researchers to identify the query…
Q: describe Genesis of an Hfr chromosome
A: Plasmids are small, extra-chromosomal DNA that are present outside the nucleus of the organism. They…
Q: determining coat color is the agouti gene?
A: The coloration, pattern, and length of the cat fur is governed by numerous genes and is determined…
Q: Explain why axis-determination is a crucial aspect of embryonic development. Explain how…
A: As per the honour code, we are entitled to do only one question at a time. So, I am providing the…
Q: name the elements that must be included in an artificialchromosome.
A: Artificial chromosomes are synthetic chromosomes which are composed of DNA fragments integrated into…
Q: What is the evidence that gene duplication has been thesource of the α and β gene families for…
A: Multiple genes in the gnathostome α-globin gene clusters are derived from a common ancestral gene…
Q: Give at least three (3) dosage forms in which liberation is altered?
A: The process by which medicine enters the body and liberates the active substance that has been…
Q: fine mecA gene.
A: Gram-positive bacterial acquire resistance to beta-lactam antibiotics through the assembly of a…
Q: Describe the basis for chromosome mapping in the Hfr x Fcrosses
A: Gene transfer is the method of inserting genetic material (DNA or a gene of interest) into cells…
Q: Explain pseudoautosomal inheritance.
A: The study of genetic variations, heredity, and genes is called genetics. The phenomenon by which…
Q: Explain the term pleiotropy.
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: Compare and contrast the molecular mechanisms leading to FX syndrome and to FSHMD.
A: Introduction :- A gene originally known as FMR1 gene by scientists and responsible for FXS is…
Q: The E132:GAL4 construct engineered into a fruit fly will cause
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Explain Synpolydactyly caused by mutations in the human HoxD13 gene.
Step by step
Solved in 2 steps
- 2.2. Describe what are missense mutations and its effects on structure and function using haemoglobin as an exampleBesides CFTR, what othe gene is associated with cystic fibrosis?Determine the reason due to which it is possible that the translation of a single mitochondrial protein might be affected specifically.
- Define Crygc gene.Explain why mutations occur in the CFTR?Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA
- Why nonhomologous end-joining (NHEJ) is helpful ?. Identify the polypeptide that is found with a-globin in human fetal hemoglobin (first appearing in the late Jurassic, about 145 million years ago, with the origin of placental mammals from marsupials). e-globin (epsilon) g-globin (gamma) d-globin (delta) b-globin (beta) z-globin (zeta)explain Mapping: Locating Genes Along aChromosome